Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Adamts16'

76916

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16

Synonyms

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70727802-70841811 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70738829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 979 (C979S)

Ref Sequence

ENSEMBL: ENSMUSP00000079041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably damaging
Transcript: ENSMUST00000080145
AA Change: C979S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: C979S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Meta Mutation Damage Score

0.8223

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70795484	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70836115	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70793141	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70800961	nonsense	probably null
IGL01874:Adamts16	APN	13	70768704	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70787147	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70772929	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70787170	splice site	probably benign
IGL02450:Adamts16	APN	13	70836300	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70738778	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70753291	missense	probably benign	0.00
swap	UTSW	13	70779518	critical splice donor site	probably benign
switcheroo	UTSW	13	70800954	missense	probably benign
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70779644	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70779611	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70791794	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70779552	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70738955	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70768647	missense	probably benign
R0524:Adamts16	UTSW	13	70800894	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70800954	missense	probably benign
R0734:Adamts16	UTSW	13	70738481	splice site	probably benign
R0826:Adamts16	UTSW	13	70768692	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70763561	splice site	probably benign
R1027:Adamts16	UTSW	13	70767802	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70791794	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70798035	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70779598	splice site	probably null
R1869:Adamts16	UTSW	13	70735747	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70791886	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70753267	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70801007	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70738891	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70767992	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70779624	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70753196	nonsense	probably null
R5464:Adamts16	UTSW	13	70761749	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70730134	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70836375	nonsense	probably null
R5735:Adamts16	UTSW	13	70836218	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70738498	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70728910	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70770274	nonsense	probably null
R6351:Adamts16	UTSW	13	70836203	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70779570	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70728898	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70768520	splice site	probably null
R6996:Adamts16	UTSW	13	70798038	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70772955	nonsense	probably null
R7356:Adamts16	UTSW	13	70836280	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70787164	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70730115	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70836146	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70738582	missense	probably benign
R8231:Adamts16	UTSW	13	70777480	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70793098	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70836377	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70738675	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70836334	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70793188	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70791791	splice site	probably benign
R8973:Adamts16	UTSW	13	70738840	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70735829	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70800926	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70761773	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTCCTTGAGCACTGCATAAGAGAG -3'
(R):5'- GCCAGAAAGCACTGCATTTGTGTC -3'

Sequencing Primer
(F):5'- AGCAAGTGGGCAAAACTTTC -3'
(R):5'- TGTCAGGTTGTCACTGGAAAAC -3'

Posted On

2013-10-16