Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Zfr'

76923

Institutional Source

Beutler Lab

Gene Symbol

Zfr

Ensembl Gene

ENSMUSG00000022201

Gene Name

zinc finger RNA binding protein

Synonyms

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12117831-12185683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12140548 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 227 (I227N)

Ref Sequence

ENSEMBL: ENSMUSP00000117207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122941] [ENSMUST00000128475] [ENSMUST00000134277]

Predicted Effect

unknown
Transcript: ENSMUST00000122941
AA Change: I227N

SMART Domains

Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: I227N

Domain	Start	End	E-Value	Type
low complexity region	69	116	N/A	INTRINSIC
low complexity region	159	182	N/A	INTRINSIC
low complexity region	196	224	N/A	INTRINSIC
low complexity region	229	302	N/A	INTRINSIC
ZnF_U1	328	362	7.79e-6	SMART
ZnF_C2H2	331	355	4.94e0	SMART
ZnF_U1	379	413	1.84e-7	SMART
ZnF_C2H2	382	406	4.65e-1	SMART
low complexity region	429	448	N/A	INTRINSIC
low complexity region	468	483	N/A	INTRINSIC
ZnF_U1	579	613	2.01e-8	SMART
ZnF_C2H2	582	606	1.31e0	SMART
low complexity region	630	664	N/A	INTRINSIC
low complexity region	685	719	N/A	INTRINSIC
low complexity region	766	782	N/A	INTRINSIC
DZF	784	1038	5.42e-170	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000128475
AA Change: I227N

SMART Domains

Protein: ENSMUSP00000117207
Gene: ENSMUSG00000022201
AA Change: I227N

Domain	Start	End	E-Value	Type
low complexity region	32	79	N/A	INTRINSIC
low complexity region	122	145	N/A	INTRINSIC
low complexity region	159	187	N/A	INTRINSIC
low complexity region	192	247	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134277

SMART Domains

Protein: ENSMUSP00000119917
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	78	125	N/A	INTRINSIC
low complexity region	168	191	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228196

Meta Mutation Damage Score

0.0828

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het

Other mutations in Zfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Zfr	APN	15	12159646	missense	probably benign	0.26
IGL01759:Zfr	APN	15	12159655	missense	probably damaging	0.99
IGL01935:Zfr	APN	15	12180712	missense	probably benign	0.42
IGL02056:Zfr	APN	15	12154447	missense	probably damaging	1.00
IGL03009:Zfr	APN	15	12162235	missense	probably damaging	1.00
IGL03147:Zfr	UTSW	15	12140552	nonsense	probably null
PIT4504001:Zfr	UTSW	15	12166158	missense	possibly damaging	0.48
R0377:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R0678:Zfr	UTSW	15	12184085	missense	probably damaging	1.00
R0783:Zfr	UTSW	15	12162182	missense	probably damaging	1.00
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1538:Zfr	UTSW	15	12150243	missense	possibly damaging	0.61
R1558:Zfr	UTSW	15	12140644	missense	unknown
R1619:Zfr	UTSW	15	12150387	missense	possibly damaging	0.52
R1924:Zfr	UTSW	15	12160629	missense	possibly damaging	0.74
R2163:Zfr	UTSW	15	12162223	missense	probably damaging	1.00
R2958:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2960:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2961:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2962:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2963:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R3012:Zfr	UTSW	15	12166163	missense	probably damaging	1.00
R3054:Zfr	UTSW	15	12154507	missense	probably damaging	1.00
R3429:Zfr	UTSW	15	12152920	missense	probably benign	0.00
R3611:Zfr	UTSW	15	12159762	critical splice donor site	probably null
R3825:Zfr	UTSW	15	12166191	missense	probably damaging	1.00
R3882:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4080:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4241:Zfr	UTSW	15	12149659	missense	probably damaging	1.00
R4366:Zfr	UTSW	15	12156330	missense	probably damaging	0.99
R4375:Zfr	UTSW	15	12118340	critical splice donor site	probably null
R4893:Zfr	UTSW	15	12136542	missense	unknown
R4899:Zfr	UTSW	15	12166145	missense	probably benign	0.11
R4915:Zfr	UTSW	15	12162112	critical splice acceptor site	probably null
R5870:Zfr	UTSW	15	12160615	missense	probably damaging	1.00
R6162:Zfr	UTSW	15	12146245	missense	unknown
R6163:Zfr	UTSW	15	12146245	missense	unknown
R6165:Zfr	UTSW	15	12146245	missense	unknown
R6187:Zfr	UTSW	15	12146231	small deletion	probably benign
R6251:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R6903:Zfr	UTSW	15	12136455	missense	unknown
R6959:Zfr	UTSW	15	12150323	missense	probably damaging	1.00
R7133:Zfr	UTSW	15	12180638	missense	probably damaging	1.00
R7167:Zfr	UTSW	15	12180929	missense	probably benign	0.01
R7212:Zfr	UTSW	15	12146223	nonsense	probably null
R7373:Zfr	UTSW	15	12140559	missense	unknown
R7489:Zfr	UTSW	15	12152982	missense	probably benign	0.24
R7602:Zfr	UTSW	15	12159677	missense	possibly damaging	0.56
R7623:Zfr	UTSW	15	12160528	missense	possibly damaging	0.83
R7896:Zfr	UTSW	15	12146377	missense	probably damaging	1.00
R8188:Zfr	UTSW	15	12171818	missense	probably damaging	1.00
R8289:Zfr	UTSW	15	12135271	missense	noncoding transcript
R8382:Zfr	UTSW	15	12152968	nonsense	probably null
R8475:Zfr	UTSW	15	12150369	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GCCAGAGATGTAGTGACATTTGGGG -3'
(R):5'- TCTGCTAAGGGCTTCTACCACCAC -3'

Sequencing Primer
(F):5'- GTCAGAATTGTATCATTGTTGCTCAC -3'
(R):5'- CCACAACATTGCTTATAGTATGGACC -3'

Posted On

2013-10-16