Mutagenetix > Incidental Mutation

Incidental Mutation 'R0787:Phf20l1'

76925

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

038967-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.328) question?

Stock #

R0787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 66615630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]

AlphaFold

Q8CCJ9

Predicted Effect

probably benign
Transcript: ENSMUST00000048188

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229486

Predicted Effect

probably benign
Transcript: ENSMUST00000229576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230250

Predicted Effect

probably benign
Transcript: ENSMUST00000230882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230915

Predicted Effect

probably benign
Transcript: ENSMUST00000230948

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Ehbp1l1	T	C	19: 5,722,668	D79G	possibly damaging	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
acadia	UTSW	15	66636820	missense	possibly damaging	0.85
curt	UTSW	15	66639948	missense	possibly damaging	0.90
Cut	UTSW	15	66613039	nonsense	probably null
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
slang	UTSW	15	66641932	missense	probably benign	0.03
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
R8857:Phf20l1	UTSW	15	66641932	missense	probably benign	0.03
R9295:Phf20l1	UTSW	15	66641903	missense	probably damaging	1.00
R9393:Phf20l1	UTSW	15	66604106	missense	probably damaging	1.00
R9442:Phf20l1	UTSW	15	66613039	nonsense	probably null
R9522:Phf20l1	UTSW	15	66632820	missense	possibly damaging	0.89
R9727:Phf20l1	UTSW	15	66615382	missense	probably benign	0.01
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCAACTGATGGCAAAGCATTCTC -3'
(R):5'- TTGCAAACAACGGCGTCTCCTC -3'

Sequencing Primer
(F):5'- CAGTCTTCAGTACCAGAGGGTAATG -3'
(R):5'- AACGGCGTCTCCTCCTTTTC -3'

Posted On

2013-10-16