Incidental Mutation 'R0787:Phf20l1'
ID76925
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene NamePHD finger protein 20-like 1
SynonymsCGI-72, E130113K22Rik
MMRRC Submission 038967-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R0787 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location66577560-66647976 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 66615630 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]
Predicted Effect probably benign
Transcript: ENSMUST00000048188
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229486
Predicted Effect probably benign
Transcript: ENSMUST00000229576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230250
Predicted Effect probably benign
Transcript: ENSMUST00000230882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230915
Predicted Effect probably benign
Transcript: ENSMUST00000230948
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T A 4: 107,890,129 L6Q probably damaging Het
1700001F09Rik A T 14: 43,345,493 probably null Het
Abca8a T A 11: 110,042,988 Y1197F possibly damaging Het
Abcc2 T C 19: 43,798,516 probably null Het
Adamts16 A T 13: 70,738,829 C979S probably damaging Het
Agap2 T A 10: 127,085,150 D523E unknown Het
Ankfy1 T A 11: 72,760,296 I1024N probably damaging Het
Ankrd13c A G 3: 157,994,678 S379G probably null Het
Arhgap40 T C 2: 158,547,790 S625P probably benign Het
Armc12 G C 17: 28,538,766 A291P probably damaging Het
Armc9 A G 1: 86,202,505 N524D probably damaging Het
Col12a1 G T 9: 79,638,485 T2305K probably damaging Het
Cyp2c54 T C 19: 40,047,635 N277S probably benign Het
E130311K13Rik A T 3: 63,920,298 V129E probably benign Het
Ehbp1l1 T C 19: 5,722,668 D79G possibly damaging Het
Epb41l1 A G 2: 156,494,090 E58G probably damaging Het
Fam217b T A 2: 178,420,909 V222E probably benign Het
Fat1 T A 8: 45,040,555 Y3913N probably damaging Het
Fgd4 A G 16: 16,423,901 probably benign Het
Hltf A T 3: 20,106,446 D759V probably damaging Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Isg15 C T 4: 156,199,939 R44H probably benign Het
Itga4 C T 2: 79,279,153 T232I probably benign Het
Kntc1 C A 5: 123,796,104 H1399Q probably benign Het
Lig1 A C 7: 13,299,069 K499Q probably benign Het
Lrrn3 C A 12: 41,454,231 C29F probably damaging Het
Mtmr10 T C 7: 64,300,615 I136T possibly damaging Het
Naip1 A G 13: 100,426,096 Y854H probably benign Het
Olfr770 T C 10: 129,133,526 N81D possibly damaging Het
Pcdh9 G A 14: 93,886,757 A659V possibly damaging Het
Phgdh A G 3: 98,334,549 V83A probably damaging Het
Pik3r1 A T 13: 101,690,523 M326K probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd1l2 T C 8: 117,076,177 D235G possibly damaging Het
Pkhd1l1 C A 15: 44,529,264 P1665Q probably damaging Het
Ppp1r7 A G 1: 93,364,956 T326A probably damaging Het
Prr22 A T 17: 56,771,072 Y75F possibly damaging Het
Ptov1 A C 7: 44,865,470 probably null Het
Rasal2 A G 1: 157,158,696 S766P probably damaging Het
Shmt1 T C 11: 60,792,976 T337A probably benign Het
St5 G T 7: 109,525,620 R1068S possibly damaging Het
Tbc1d4 A T 14: 101,449,209 I1168N probably damaging Het
Tecpr2 T C 12: 110,946,343 V1126A probably benign Het
Tep1 A T 14: 50,829,230 S2304T possibly damaging Het
Tiam1 C A 16: 89,789,561 R1446M probably damaging Het
Tmem87a T C 2: 120,370,484 I425V probably benign Het
Ubr3 T C 2: 69,951,421 probably benign Het
Ubxn7 T A 16: 32,381,763 probably benign Het
Vmn2r13 A G 5: 109,156,847 S573P probably damaging Het
Wdfy3 A T 5: 101,957,388 V191E probably damaging Het
Zdhhc3 A T 9: 123,083,623 C153* probably null Het
Zfp407 A T 18: 84,209,022 V2154D probably damaging Het
Zfp407 A G 18: 84,209,346 V2046A probably benign Het
Zfr T A 15: 12,140,548 I227N unknown Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66629035 missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66615633 splice site probably benign
IGL00668:Phf20l1 APN 15 66632849 missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66636832 missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66641908 missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66613132 missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66597691 missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66628991 missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66640025 missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66615410 critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66641801 missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66615632 splice site probably benign
IGL02656:Phf20l1 APN 15 66629827 missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66604864 missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66594980 critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66595151 missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66594884 missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66641947 utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66597403 missense probably damaging 1.00
PIT4305001:Phf20l1 UTSW 15 66613052 missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66609604 missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66595122 missense probably damaging 1.00
R1458:Phf20l1 UTSW 15 66604813 missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66615259 missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66632825 missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66594920 missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66641816 missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66604837 missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66615222 missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66597367 missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66604855 missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66636913 missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66615785 missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66636820 missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66636824 missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66632903 critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66629824 missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66609547 missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66630913 missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66604840 missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66604789 missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66597750 missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66636884 missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66604084 missense probably benign 0.02
X0065:Phf20l1 UTSW 15 66597678 missense probably damaging 0.99
X0065:Phf20l1 UTSW 15 66629806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCAACTGATGGCAAAGCATTCTC -3'
(R):5'- TTGCAAACAACGGCGTCTCCTC -3'

Sequencing Primer
(F):5'- CAGTCTTCAGTACCAGAGGGTAATG -3'
(R):5'- AACGGCGTCTCCTCCTTTTC -3'
Posted On2013-10-16