Mutagenetix > Incidental Mutations

Incidental Mutation 'R0787:Ehbp1l1'

76934

Institutional Source

Beutler Lab

Gene Symbol

Ehbp1l1

Ensembl Gene

ENSMUSG00000024937

Gene Name

EH domain binding protein 1-like 1

Synonyms

MMRRC Submission

038967-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0787 (G1)

Quality Score

208

Status

Validated

Chromosome

Chromosomal Location

5707376-5726317 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5722668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 79 (D79G)

Ref Sequence

ENSEMBL: ENSMUSP00000126740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049295
AA Change: D79G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: D79G

Domain	Start	End	E-Value	Type
Pfam:NT-C2	12	164	3.2e-24	PFAM
low complexity region	245	256	N/A	INTRINSIC
low complexity region	276	291	N/A	INTRINSIC
internal_repeat_1	442	821	1.71e-12	PROSPERO
internal_repeat_1	833	1197	1.71e-12	PROSPERO
CH	1212	1310	3.55e-16	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1426	1449	N/A	INTRINSIC
low complexity region	1471	1484	N/A	INTRINSIC
low complexity region	1493	1547	N/A	INTRINSIC
DUF3585	1552	1696	6.7e-59	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075606
AA Change: D79G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937
AA Change: D79G

Domain	Start	End	E-Value	Type
Pfam:NT-C2	12	164	3.9e-25	PFAM
CH	268	366	3.55e-16	SMART
low complexity region	372	387	N/A	INTRINSIC
low complexity region	482	505	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	549	603	N/A	INTRINSIC
DUF3585	608	752	6.7e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162407

Meta Mutation Damage Score

0.4445

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	A	4: 107,890,129	L6Q	probably damaging	Het
1700001F09Rik	A	T	14: 43,345,493		probably null	Het
Abca8a	T	A	11: 110,042,988	Y1197F	possibly damaging	Het
Abcc2	T	C	19: 43,798,516		probably null	Het
Adamts16	A	T	13: 70,738,829	C979S	probably damaging	Het
Agap2	T	A	10: 127,085,150	D523E	unknown	Het
Ankfy1	T	A	11: 72,760,296	I1024N	probably damaging	Het
Ankrd13c	A	G	3: 157,994,678	S379G	probably null	Het
Arhgap40	T	C	2: 158,547,790	S625P	probably benign	Het
Armc12	G	C	17: 28,538,766	A291P	probably damaging	Het
Armc9	A	G	1: 86,202,505	N524D	probably damaging	Het
Col12a1	G	T	9: 79,638,485	T2305K	probably damaging	Het
Cyp2c54	T	C	19: 40,047,635	N277S	probably benign	Het
E130311K13Rik	A	T	3: 63,920,298	V129E	probably benign	Het
Epb41l1	A	G	2: 156,494,090	E58G	probably damaging	Het
Fam217b	T	A	2: 178,420,909	V222E	probably benign	Het
Fat1	T	A	8: 45,040,555	Y3913N	probably damaging	Het
Fgd4	A	G	16: 16,423,901		probably benign	Het
Hltf	A	T	3: 20,106,446	D759V	probably damaging	Het
Hsp90ab1	ACTTCTT	ACTT	17: 45,569,499		probably benign	Het
Isg15	C	T	4: 156,199,939	R44H	probably benign	Het
Itga4	C	T	2: 79,279,153	T232I	probably benign	Het
Kntc1	C	A	5: 123,796,104	H1399Q	probably benign	Het
Lig1	A	C	7: 13,299,069	K499Q	probably benign	Het
Lrrn3	C	A	12: 41,454,231	C29F	probably damaging	Het
Mtmr10	T	C	7: 64,300,615	I136T	possibly damaging	Het
Naip1	A	G	13: 100,426,096	Y854H	probably benign	Het
Olfr770	T	C	10: 129,133,526	N81D	possibly damaging	Het
Pcdh9	G	A	14: 93,886,757	A659V	possibly damaging	Het
Phf20l1	T	A	15: 66,615,630		probably benign	Het
Phgdh	A	G	3: 98,334,549	V83A	probably damaging	Het
Pik3r1	A	T	13: 101,690,523	M326K	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkd1l2	T	C	8: 117,076,177	D235G	possibly damaging	Het
Pkhd1l1	C	A	15: 44,529,264	P1665Q	probably damaging	Het
Ppp1r7	A	G	1: 93,364,956	T326A	probably damaging	Het
Prr22	A	T	17: 56,771,072	Y75F	possibly damaging	Het
Ptov1	A	C	7: 44,865,470		probably null	Het
Rasal2	A	G	1: 157,158,696	S766P	probably damaging	Het
Shmt1	T	C	11: 60,792,976	T337A	probably benign	Het
St5	G	T	7: 109,525,620	R1068S	possibly damaging	Het
Tbc1d4	A	T	14: 101,449,209	I1168N	probably damaging	Het
Tecpr2	T	C	12: 110,946,343	V1126A	probably benign	Het
Tep1	A	T	14: 50,829,230	S2304T	possibly damaging	Het
Tiam1	C	A	16: 89,789,561	R1446M	probably damaging	Het
Tmem87a	T	C	2: 120,370,484	I425V	probably benign	Het
Ubr3	T	C	2: 69,951,421		probably benign	Het
Ubxn7	T	A	16: 32,381,763		probably benign	Het
Vmn2r13	A	G	5: 109,156,847	S573P	probably damaging	Het
Wdfy3	A	T	5: 101,957,388	V191E	probably damaging	Het
Zdhhc3	A	T	9: 123,083,623	C153*	probably null	Het
Zfp407	A	T	18: 84,209,022	V2154D	probably damaging	Het
Zfp407	A	G	18: 84,209,346	V2046A	probably benign	Het
Zfr	T	A	15: 12,140,548	I227N	unknown	Het

Other mutations in Ehbp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Ehbp1l1	APN	19	5717933	missense	probably benign	0.33
IGL01061:Ehbp1l1	APN	19	5717888	missense	probably benign
IGL01372:Ehbp1l1	APN	19	5715789	splice site	probably benign
IGL01790:Ehbp1l1	APN	19	5722984	missense	probably damaging	0.99
IGL01936:Ehbp1l1	APN	19	5718249	nonsense	probably null
IGL02194:Ehbp1l1	APN	19	5718857	missense	probably benign
IGL02347:Ehbp1l1	APN	19	5719572	missense	possibly damaging	0.72
IGL02372:Ehbp1l1	APN	19	5710834	missense	possibly damaging	0.53
IGL02681:Ehbp1l1	APN	19	5720825	missense	probably damaging	0.98
IGL02824:Ehbp1l1	APN	19	5719298	missense	probably benign
IGL03070:Ehbp1l1	APN	19	5715953	missense	probably benign	0.33
IGL03146:Ehbp1l1	APN	19	5720033	missense	probably benign	0.00
PIT4802001:Ehbp1l1	UTSW	19	5719575	missense	possibly damaging	0.93
R0309:Ehbp1l1	UTSW	19	5720570	missense	possibly damaging	0.72
R1156:Ehbp1l1	UTSW	19	5708336	unclassified	probably benign
R1337:Ehbp1l1	UTSW	19	5718230	missense	probably benign	0.00
R1474:Ehbp1l1	UTSW	19	5719084	missense	possibly damaging	0.86
R1501:Ehbp1l1	UTSW	19	5716424	missense	probably damaging	0.98
R1582:Ehbp1l1	UTSW	19	5721967	missense	possibly damaging	0.83
R1766:Ehbp1l1	UTSW	19	5716406	missense	probably damaging	0.98
R1838:Ehbp1l1	UTSW	19	5717691	missense	probably benign	0.39
R1842:Ehbp1l1	UTSW	19	5725930	missense	probably damaging	0.99
R1863:Ehbp1l1	UTSW	19	5717854	missense	probably benign	0.01
R1955:Ehbp1l1	UTSW	19	5710669	missense	possibly damaging	0.51
R2010:Ehbp1l1	UTSW	19	5719283	missense	probably benign
R2098:Ehbp1l1	UTSW	19	5708658	missense	possibly damaging	0.93
R2099:Ehbp1l1	UTSW	19	5718401	missense	possibly damaging	0.72
R2852:Ehbp1l1	UTSW	19	5716487	missense	probably damaging	0.99
R3113:Ehbp1l1	UTSW	19	5718980	missense	probably benign	0.38
R3799:Ehbp1l1	UTSW	19	5719115	missense	probably benign	0.33
R3891:Ehbp1l1	UTSW	19	5718312	missense	possibly damaging	0.73
R3964:Ehbp1l1	UTSW	19	5710573	critical splice donor site	probably null
R3966:Ehbp1l1	UTSW	19	5710573	critical splice donor site	probably null
R4335:Ehbp1l1	UTSW	19	5708769	missense	probably damaging	0.98
R4434:Ehbp1l1	UTSW	19	5716248	missense	possibly damaging	0.93
R4457:Ehbp1l1	UTSW	19	5716293	missense	possibly damaging	0.83
R4597:Ehbp1l1	UTSW	19	5717927	missense	possibly damaging	0.72
R4726:Ehbp1l1	UTSW	19	5719176	missense	possibly damaging	0.70
R4761:Ehbp1l1	UTSW	19	5719847	missense	possibly damaging	0.93
R4771:Ehbp1l1	UTSW	19	5725968	missense	probably damaging	1.00
R5402:Ehbp1l1	UTSW	19	5716320	missense	possibly damaging	0.91
R5436:Ehbp1l1	UTSW	19	5716248	missense	possibly damaging	0.93
R5602:Ehbp1l1	UTSW	19	5708670	missense	possibly damaging	0.85
R5893:Ehbp1l1	UTSW	19	5718431	missense	probably benign
R6329:Ehbp1l1	UTSW	19	5718767	missense	possibly damaging	0.53
R6416:Ehbp1l1	UTSW	19	5718757	missense	probably benign	0.01
R7106:Ehbp1l1	UTSW	19	5718737	missense	probably benign	0.33
R7262:Ehbp1l1	UTSW	19	5718446	nonsense	probably null
R7304:Ehbp1l1	UTSW	19	5716382	missense	probably damaging	1.00
R7317:Ehbp1l1	UTSW	19	5720702	missense	probably benign	0.44
R7404:Ehbp1l1	UTSW	19	5720844	missense	possibly damaging	0.72
R7447:Ehbp1l1	UTSW	19	5719428	missense	possibly damaging	0.53
R7862:Ehbp1l1	UTSW	19	5720823	missense	probably benign
R7881:Ehbp1l1	UTSW	19	5719398	missense	probably benign
R7910:Ehbp1l1	UTSW	19	5716424	missense	probably benign	0.28
R8239:Ehbp1l1	UTSW	19	5720061	missense	possibly damaging	0.53
R8309:Ehbp1l1	UTSW	19	5717075	missense	probably damaging	1.00
R8324:Ehbp1l1	UTSW	19	5719998	missense	possibly damaging	0.86
R8724:Ehbp1l1	UTSW	19	5715858	missense	possibly damaging	0.73
R9260:Ehbp1l1	UTSW	19	5719250	missense	probably benign	0.07
RF053:Ehbp1l1	UTSW	19	5716002	small deletion	probably benign
Z1088:Ehbp1l1	UTSW	19	5716287	missense	possibly damaging	0.77
Z1176:Ehbp1l1	UTSW	19	5717889	missense	probably benign
Z1177:Ehbp1l1	UTSW	19	5718762	missense	probably damaging	0.99
Z1177:Ehbp1l1	UTSW	19	5719101	missense	probably benign	0.07
Z1177:Ehbp1l1	UTSW	19	5719102	missense	probably benign	0.01
Z1177:Ehbp1l1	UTSW	19	5719434	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCACAAAATCTTTGGTTCCACGATTTGG -3'
(R):5'- GGCAGCCTGACAAGCTGGTG -3'

Sequencing Primer
(F):5'- GTTCTTTCATTGTGGGTGAAAACC -3'
(R):5'- CGAAGGATCTGCTCCAAGGTG -3'

Posted On

2013-10-16