Mutagenetix > Incidental Mutation

Incidental Mutation 'R0771:Chd6'

76944

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

038951-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R0771 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 161019580 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 516 (L516F)

Ref Sequence

ENSEMBL: ENSMUSP00000123240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: L517F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: L517F

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000134178
AA Change: L516F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: L516F

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138078

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.2%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abr	T	C	11: 76,455,683 (GRCm38)	E434G	probably damaging	Het
Adam19	G	A	11: 46,121,453 (GRCm38)	V259I	possibly damaging	Het
Adam5	A	G	8: 24,786,299 (GRCm38)	S451P	probably benign	Het
Elovl4	A	G	9: 83,785,115 (GRCm38)	V154A	possibly damaging	Het
Gadl1	G	A	9: 115,944,232 (GRCm38)	R114Q	probably damaging	Het
Ipo13	T	C	4: 117,894,646 (GRCm38)	N936S	possibly damaging	Het
Kcnd2	T	A	6: 21,216,442 (GRCm38)	S48R	probably damaging	Het
Lgalsl2	A	G	7: 5,359,823 (GRCm38)	D151G	probably damaging	Het
Lim2	C	A	7: 43,430,703 (GRCm38)	A38E	possibly damaging	Het
Lrp2	A	T	2: 69,507,990 (GRCm38)	D1177E	probably damaging	Het
Mdh1	C	T	11: 21,557,550 (GRCm38)	V300I	probably benign	Het
Mfsd4b4	T	C	10: 39,892,411 (GRCm38)	T275A	probably benign	Het
Myo10	A	G	15: 25,778,178 (GRCm38)	Y114C	probably damaging	Het
Ncapg2	T	A	12: 116,413,159 (GRCm38)	C122*	probably null	Het
Nod1	T	G	6: 54,944,269 (GRCm38)	S355R	probably damaging	Het
Or52x1	T	A	7: 105,204,161 (GRCm38)	M61L	possibly damaging	Het
Or5ap2	A	T	2: 85,849,994 (GRCm38)	I181F	possibly damaging	Het
Pcsk1	A	T	13: 75,132,162 (GRCm38)	E702V	probably benign	Het
Ptpn21	T	C	12: 98,689,080 (GRCm38)	T543A	probably damaging	Het
Ranbp9	T	C	13: 43,461,773 (GRCm38)	I190V	possibly damaging	Het
Sirpd	T	A	3: 15,320,446 (GRCm38)	Q132L	probably benign	Het
Slc1a4	C	T	11: 20,306,467 (GRCm38)	V455M	probably damaging	Het
Srbd1	T	A	17: 86,130,254 (GRCm38)	E220D	probably benign	Het
Thsd7a	A	G	6: 12,327,577 (GRCm38)	V1432A	probably benign	Het
Zfp61	T	C	7: 24,293,354 (GRCm38)	R71G	probably benign	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161,042,079 (GRCm38)	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161,029,298 (GRCm38)	splice site	probably benign
IGL01104:Chd6	APN	2	160,961,927 (GRCm38)	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160,988,370 (GRCm38)	splice site	probably benign
IGL01717:Chd6	APN	2	160,965,259 (GRCm38)	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160,961,374 (GRCm38)	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161,059,929 (GRCm38)	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160,983,678 (GRCm38)	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160,977,512 (GRCm38)	missense	probably benign
IGL02158:Chd6	APN	2	161,026,292 (GRCm38)	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160,965,675 (GRCm38)	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160,984,452 (GRCm38)	splice site	probably benign
IGL02522:Chd6	APN	2	160,965,796 (GRCm38)	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161,039,350 (GRCm38)	splice site	probably benign
IGL02727:Chd6	APN	2	160,969,463 (GRCm38)	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160,965,698 (GRCm38)	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160,960,263 (GRCm38)	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160,984,632 (GRCm38)	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160,990,301 (GRCm38)	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161,019,616 (GRCm38)	nonsense	probably null
IGL02979:Chd6	APN	2	160,966,170 (GRCm38)	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161,052,384 (GRCm38)	splice site	probably benign
IGL03277:Chd6	APN	2	160,983,061 (GRCm38)	missense	probably null	1.00
IGL03346:Chd6	APN	2	160,960,362 (GRCm38)	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161,018,016 (GRCm38)	splice site	probably benign
IGL03134:Chd6	UTSW	2	160,965,483 (GRCm38)	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160,967,902 (GRCm38)	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160,967,902 (GRCm38)	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161,052,847 (GRCm38)	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161,014,324 (GRCm38)	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161,052,688 (GRCm38)	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160,992,191 (GRCm38)	missense	probably damaging	0.99
R1147:Chd6	UTSW	2	160,990,271 (GRCm38)	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160,990,271 (GRCm38)	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161,030,802 (GRCm38)	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160,967,815 (GRCm38)	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160,983,103 (GRCm38)	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161,042,058 (GRCm38)	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161,042,058 (GRCm38)	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160,981,667 (GRCm38)	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160,966,639 (GRCm38)	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160,990,256 (GRCm38)	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160,968,000 (GRCm38)	splice site	probably benign
R1973:Chd6	UTSW	2	160,966,387 (GRCm38)	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160,983,753 (GRCm38)	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160,965,759 (GRCm38)	frame shift	probably null
R2341:Chd6	UTSW	2	160,965,759 (GRCm38)	frame shift	probably null
R2519:Chd6	UTSW	2	161,029,876 (GRCm38)	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160,967,880 (GRCm38)	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160,966,552 (GRCm38)	small deletion	probably benign
R3426:Chd6	UTSW	2	160,990,255 (GRCm38)	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160,990,255 (GRCm38)	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160,988,333 (GRCm38)	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160,961,291 (GRCm38)	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160,949,856 (GRCm38)	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160,965,318 (GRCm38)	missense	probably benign
R4458:Chd6	UTSW	2	161,029,876 (GRCm38)	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161,014,194 (GRCm38)	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160,969,492 (GRCm38)	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160,970,183 (GRCm38)	missense	probably benign
R4765:Chd6	UTSW	2	160,966,244 (GRCm38)	nonsense	probably null
R4779:Chd6	UTSW	2	160,949,557 (GRCm38)	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161,029,299 (GRCm38)	splice site	probably benign
R5068:Chd6	UTSW	2	160,966,369 (GRCm38)	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160,949,953 (GRCm38)	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160,969,363 (GRCm38)	missense	probably benign
R5405:Chd6	UTSW	2	160,965,390 (GRCm38)	missense	probably benign
R5598:Chd6	UTSW	2	161,014,112 (GRCm38)	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160,965,265 (GRCm38)	missense	probably benign
R5697:Chd6	UTSW	2	161,018,051 (GRCm38)	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160,949,878 (GRCm38)	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160,983,762 (GRCm38)	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160,957,079 (GRCm38)	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160,957,078 (GRCm38)	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160,965,827 (GRCm38)	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160,965,582 (GRCm38)	missense	probably benign
R6104:Chd6	UTSW	2	161,014,132 (GRCm38)	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160,950,048 (GRCm38)	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160,979,487 (GRCm38)	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160,965,498 (GRCm38)	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161,013,067 (GRCm38)	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160,966,254 (GRCm38)	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160,960,359 (GRCm38)	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160,965,730 (GRCm38)	missense	probably benign
R6895:Chd6	UTSW	2	160,988,340 (GRCm38)	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161,013,127 (GRCm38)	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161,025,965 (GRCm38)	nonsense	probably null
R7064:Chd6	UTSW	2	160,950,063 (GRCm38)	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160,961,279 (GRCm38)	nonsense	probably null
R7287:Chd6	UTSW	2	161,008,392 (GRCm38)	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161,026,328 (GRCm38)	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160,950,003 (GRCm38)	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161,013,154 (GRCm38)	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161,025,943 (GRCm38)	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160,966,619 (GRCm38)	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160,970,175 (GRCm38)	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160,990,321 (GRCm38)	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160,957,082 (GRCm38)	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160,990,321 (GRCm38)	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161,019,651 (GRCm38)	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161,021,069 (GRCm38)	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161,021,069 (GRCm38)	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160,981,623 (GRCm38)	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161,029,873 (GRCm38)	nonsense	probably null
R9270:Chd6	UTSW	2	161,029,873 (GRCm38)	nonsense	probably null
R9310:Chd6	UTSW	2	161,039,261 (GRCm38)	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161,029,864 (GRCm38)	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160,957,158 (GRCm38)	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160,960,339 (GRCm38)	missense	probably benign
Z1088:Chd6	UTSW	2	160,966,488 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGAAGTCAGCCTCAGCAGATAG -3'
(R):5'- AAAGCCTTCATTAACCTCACAGGTCAG -3'

Sequencing Primer
(F):5'- AGATACGGATTGGAGCCCC -3'
(R):5'- ACCTCACAGGTCAGAGTTTTAG -3'

Posted On

2013-10-16