Incidental Mutation 'R0771:Lim2'
ID76952
Institutional Source Beutler Lab
Gene Symbol Lim2
Ensembl Gene ENSMUSG00000093639
Gene Name
Synonyms19kDa, MP19
MMRRC Submission 038951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R0771 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43427670-43435996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43430703 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 38 (A38E)
Ref Sequence ENSEMBL: ENSMUSP00000004732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004732] [ENSMUST00000177375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004732
AA Change: A38E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000004732
Gene: ENSMUSG00000093639
AA Change: A38E

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 157 5.5e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177375
SMART Domains Protein: ENSMUSP00000135834
Gene: ENSMUSG00000093639

DomainStartEndE-ValueType
low complexity region 26 46 N/A INTRINSIC
low complexity region 116 131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an eye lens-specific protein found at the junctions of lens fiber cells, where it may contribute to cell junctional organization. It acts as a receptor for calmodulin, and may play an important role in both lens development and cataractogenesis. Mutations in this gene have been associated with cataract formation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutants exhibit microphthalmia, total lens opacity, disorganized lens fibers, posterior rupturing of lens capsule, and some have vacuolated lens. Heterozygotes exhibit the same dense cataract, but without microphthalmia or lens rupture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,683 E434G probably damaging Het
Adam19 G A 11: 46,121,453 V259I possibly damaging Het
Adam5 A G 8: 24,786,299 S451P probably benign Het
Chd6 G A 2: 161,019,580 L516F probably damaging Het
Elovl4 A G 9: 83,785,115 V154A possibly damaging Het
Gadl1 G A 9: 115,944,232 R114Q probably damaging Het
Gm5065 A G 7: 5,359,823 D151G probably damaging Het
Gm9733 T A 3: 15,320,446 Q132L probably benign Het
Ipo13 T C 4: 117,894,646 N936S possibly damaging Het
Kcnd2 T A 6: 21,216,442 S48R probably damaging Het
Lrp2 A T 2: 69,507,990 D1177E probably damaging Het
Mdh1 C T 11: 21,557,550 V300I probably benign Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Myo10 A G 15: 25,778,178 Y114C probably damaging Het
Ncapg2 T A 12: 116,413,159 C122* probably null Het
Nod1 T G 6: 54,944,269 S355R probably damaging Het
Olfr1020 A T 2: 85,849,994 I181F possibly damaging Het
Olfr686 T A 7: 105,204,161 M61L possibly damaging Het
Pcsk1 A T 13: 75,132,162 E702V probably benign Het
Ptpn21 T C 12: 98,689,080 T543A probably damaging Het
Ranbp9 T C 13: 43,461,773 I190V possibly damaging Het
Slc1a4 C T 11: 20,306,467 V455M probably damaging Het
Srbd1 T A 17: 86,130,254 E220D probably benign Het
Thsd7a A G 6: 12,327,577 V1432A probably benign Het
Zfp61 T C 7: 24,293,354 R71G probably benign Het
Other mutations in Lim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03166:Lim2 APN 7 43430623 nonsense probably null
R1006:Lim2 UTSW 7 43435402 missense probably damaging 1.00
R4693:Lim2 UTSW 7 43430681 missense probably damaging 1.00
R6194:Lim2 UTSW 7 43435662 missense probably damaging 1.00
R6723:Lim2 UTSW 7 43435675 missense probably benign
R7658:Lim2 UTSW 7 43433630 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GAATGAAGAATCCAGACTTCCCGCC -3'
(R):5'- AGATGCAAAGCCTGTTCCATCCC -3'

Sequencing Primer
(F):5'- TCACTCAAGGGTCCAGATTCC -3'
(R):5'- TTAGTGCAAGGACCTGTACC -3'
Posted On2013-10-16