Incidental Mutation 'R0771:Olfr686'
ID76953
Institutional Source Beutler Lab
Gene Symbol Olfr686
Ensembl Gene ENSMUSG00000048425
Gene Nameolfactory receptor 686
SynonymsGA_x6K02T2PBJ9-7832633-7831680, MOR35-1
MMRRC Submission 038951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0771 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105201858-105207485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105204161 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 61 (M61L)
Ref Sequence ENSEMBL: ENSMUSP00000148898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050157] [ENSMUST00000214147] [ENSMUST00000216143] [ENSMUST00000216613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050157
AA Change: M61L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049601
Gene: ENSMUSG00000048425
AA Change: M61L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8e-92 PFAM
Pfam:7TM_GPCR_Srsx 37 229 3e-9 PFAM
Pfam:7tm_1 43 294 9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214147
AA Change: M61L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216143
AA Change: M61L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216613
AA Change: M61L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,683 E434G probably damaging Het
Adam19 G A 11: 46,121,453 V259I possibly damaging Het
Adam5 A G 8: 24,786,299 S451P probably benign Het
Chd6 G A 2: 161,019,580 L516F probably damaging Het
Elovl4 A G 9: 83,785,115 V154A possibly damaging Het
Gadl1 G A 9: 115,944,232 R114Q probably damaging Het
Gm5065 A G 7: 5,359,823 D151G probably damaging Het
Gm9733 T A 3: 15,320,446 Q132L probably benign Het
Ipo13 T C 4: 117,894,646 N936S possibly damaging Het
Kcnd2 T A 6: 21,216,442 S48R probably damaging Het
Lim2 C A 7: 43,430,703 A38E possibly damaging Het
Lrp2 A T 2: 69,507,990 D1177E probably damaging Het
Mdh1 C T 11: 21,557,550 V300I probably benign Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Myo10 A G 15: 25,778,178 Y114C probably damaging Het
Ncapg2 T A 12: 116,413,159 C122* probably null Het
Nod1 T G 6: 54,944,269 S355R probably damaging Het
Olfr1020 A T 2: 85,849,994 I181F possibly damaging Het
Pcsk1 A T 13: 75,132,162 E702V probably benign Het
Ptpn21 T C 12: 98,689,080 T543A probably damaging Het
Ranbp9 T C 13: 43,461,773 I190V possibly damaging Het
Slc1a4 C T 11: 20,306,467 V455M probably damaging Het
Srbd1 T A 17: 86,130,254 E220D probably benign Het
Thsd7a A G 6: 12,327,577 V1432A probably benign Het
Zfp61 T C 7: 24,293,354 R71G probably benign Het
Other mutations in Olfr686
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Olfr686 APN 7 105203906 missense probably benign 0.01
R0112:Olfr686 UTSW 7 105203659 missense probably benign 0.05
R0234:Olfr686 UTSW 7 105203614 missense probably damaging 1.00
R0234:Olfr686 UTSW 7 105203614 missense probably damaging 1.00
R0541:Olfr686 UTSW 7 105204160 missense probably damaging 0.99
R3944:Olfr686 UTSW 7 105203955 nonsense probably null
R4079:Olfr686 UTSW 7 105204021 missense probably damaging 1.00
R4929:Olfr686 UTSW 7 105204025 missense probably damaging 1.00
R4978:Olfr686 UTSW 7 105204191 missense probably benign 0.02
R6267:Olfr686 UTSW 7 105203392 missense probably damaging 1.00
R6302:Olfr686 UTSW 7 105203719 missense probably damaging 1.00
R6483:Olfr686 UTSW 7 105204293 missense probably benign
R7787:Olfr686 UTSW 7 105204045 nonsense probably null
R7804:Olfr686 UTSW 7 105204160 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCAACAACTTCAGGCGTAAGGATG -3'
(R):5'- CTGTAAGGCAAAAGTGATGTGGTGC -3'

Sequencing Primer
(F):5'- TGGGTTACAGATAGCCACAAATC -3'
(R):5'- GTGAGACCATACAACCTGACTTTC -3'
Posted On2013-10-16