Incidental Mutation 'R0771:Slc1a4'
ID76958
Institutional Source Beutler Lab
Gene Symbol Slc1a4
Ensembl Gene ENSMUSG00000020142
Gene Namesolute carrier family 1 (glutamate/neutral amino acid transporter), member 4
SynonymsASCT1
MMRRC Submission 038951-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0771 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location20302180-20332713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20306467 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 455 (V455M)
Ref Sequence ENSEMBL: ENSMUSP00000105223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004634] [ENSMUST00000109594]
Predicted Effect probably damaging
Transcript: ENSMUST00000004634
AA Change: V375M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004634
Gene: ENSMUSG00000020142
AA Change: V375M

DomainStartEndE-ValueType
Pfam:SDF 1 397 2.7e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109594
AA Change: V455M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105223
Gene: ENSMUSG00000020142
AA Change: V455M

DomainStartEndE-ValueType
Pfam:SDF 44 477 4.2e-121 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent neutral amino acid transporter for alanine, serine, cysteine, and threonine. Defects in this gene have been associated with developmental delay, microcephaly, and intellectual disability. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,683 E434G probably damaging Het
Adam19 G A 11: 46,121,453 V259I possibly damaging Het
Adam5 A G 8: 24,786,299 S451P probably benign Het
Chd6 G A 2: 161,019,580 L516F probably damaging Het
Elovl4 A G 9: 83,785,115 V154A possibly damaging Het
Gadl1 G A 9: 115,944,232 R114Q probably damaging Het
Gm5065 A G 7: 5,359,823 D151G probably damaging Het
Gm9733 T A 3: 15,320,446 Q132L probably benign Het
Ipo13 T C 4: 117,894,646 N936S possibly damaging Het
Kcnd2 T A 6: 21,216,442 S48R probably damaging Het
Lim2 C A 7: 43,430,703 A38E possibly damaging Het
Lrp2 A T 2: 69,507,990 D1177E probably damaging Het
Mdh1 C T 11: 21,557,550 V300I probably benign Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Myo10 A G 15: 25,778,178 Y114C probably damaging Het
Ncapg2 T A 12: 116,413,159 C122* probably null Het
Nod1 T G 6: 54,944,269 S355R probably damaging Het
Olfr1020 A T 2: 85,849,994 I181F possibly damaging Het
Olfr686 T A 7: 105,204,161 M61L possibly damaging Het
Pcsk1 A T 13: 75,132,162 E702V probably benign Het
Ptpn21 T C 12: 98,689,080 T543A probably damaging Het
Ranbp9 T C 13: 43,461,773 I190V possibly damaging Het
Srbd1 T A 17: 86,130,254 E220D probably benign Het
Thsd7a A G 6: 12,327,577 V1432A probably benign Het
Zfp61 T C 7: 24,293,354 R71G probably benign Het
Other mutations in Slc1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Slc1a4 APN 11 20308644 splice site probably benign
IGL01889:Slc1a4 APN 11 20314089 splice site probably benign
IGL02725:Slc1a4 APN 11 20308408 missense probably damaging 1.00
IGL03409:Slc1a4 APN 11 20306506 missense probably damaging 1.00
R0085:Slc1a4 UTSW 11 20304510 splice site probably benign
R0898:Slc1a4 UTSW 11 20304349 missense probably damaging 1.00
R1326:Slc1a4 UTSW 11 20332159 missense probably damaging 1.00
R1992:Slc1a4 UTSW 11 20304375 missense probably benign 0.31
R2497:Slc1a4 UTSW 11 20332620 start gained probably benign
R3498:Slc1a4 UTSW 11 20313973 missense probably damaging 1.00
R4608:Slc1a4 UTSW 11 20304348 missense probably damaging 1.00
R4631:Slc1a4 UTSW 11 20308452 missense probably damaging 1.00
R4885:Slc1a4 UTSW 11 20304384 missense probably damaging 1.00
R4911:Slc1a4 UTSW 11 20332166 missense probably damaging 1.00
R5533:Slc1a4 UTSW 11 20304417 missense probably benign 0.01
R5548:Slc1a4 UTSW 11 20304429 missense possibly damaging 0.68
R6523:Slc1a4 UTSW 11 20332114 missense probably damaging 1.00
R6863:Slc1a4 UTSW 11 20314001 missense probably damaging 1.00
R6941:Slc1a4 UTSW 11 20304346 missense probably damaging 1.00
R7508:Slc1a4 UTSW 11 20306487 missense probably damaging 1.00
R7747:Slc1a4 UTSW 11 20308587 missense probably damaging 1.00
R7748:Slc1a4 UTSW 11 20332252 missense probably damaging 1.00
R7934:Slc1a4 UTSW 11 20308518 missense probably damaging 1.00
R8142:Slc1a4 UTSW 11 20307890 critical splice donor site probably null
R8301:Slc1a4 UTSW 11 20332286 missense probably damaging 1.00
R8398:Slc1a4 UTSW 11 20307982 missense probably damaging 1.00
X0025:Slc1a4 UTSW 11 20318703 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCATTTGCACAGCCCCTTGAAC -3'
(R):5'- TTGCTGTACCCTAGAGTGACTGCC -3'

Sequencing Primer
(F):5'- TACTACAGGCAAGTCCTGGATG -3'
(R):5'- AGTGACTGCCACGGCATC -3'
Posted On2013-10-16