Incidental Mutation 'R0771:Mdh1'
ID76959
Institutional Source Beutler Lab
Gene Symbol Mdh1
Ensembl Gene ENSMUSG00000020321
Gene Namemalate dehydrogenase 1, NAD (soluble)
SynonymsMor2, MDH-s, Mor-2, B230377B03Rik
MMRRC Submission 038951-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0771 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21556787-21572367 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21557550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 300 (V300I)
Ref Sequence ENSEMBL: ENSMUSP00000099938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102874]
Predicted Effect probably benign
Transcript: ENSMUST00000102874
AA Change: V300I

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099938
Gene: ENSMUSG00000020321
AA Change: V300I

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 7.3e-41 PFAM
Pfam:Ldh_1_C 156 331 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146146
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. A pseudogene has been identified on chromosomes 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: An ENU-induced mutation results in prenatal lethality in homozygotes and decreased enzyme activity in heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,683 E434G probably damaging Het
Adam19 G A 11: 46,121,453 V259I possibly damaging Het
Adam5 A G 8: 24,786,299 S451P probably benign Het
Chd6 G A 2: 161,019,580 L516F probably damaging Het
Elovl4 A G 9: 83,785,115 V154A possibly damaging Het
Gadl1 G A 9: 115,944,232 R114Q probably damaging Het
Gm5065 A G 7: 5,359,823 D151G probably damaging Het
Gm9733 T A 3: 15,320,446 Q132L probably benign Het
Ipo13 T C 4: 117,894,646 N936S possibly damaging Het
Kcnd2 T A 6: 21,216,442 S48R probably damaging Het
Lim2 C A 7: 43,430,703 A38E possibly damaging Het
Lrp2 A T 2: 69,507,990 D1177E probably damaging Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Myo10 A G 15: 25,778,178 Y114C probably damaging Het
Ncapg2 T A 12: 116,413,159 C122* probably null Het
Nod1 T G 6: 54,944,269 S355R probably damaging Het
Olfr1020 A T 2: 85,849,994 I181F possibly damaging Het
Olfr686 T A 7: 105,204,161 M61L possibly damaging Het
Pcsk1 A T 13: 75,132,162 E702V probably benign Het
Ptpn21 T C 12: 98,689,080 T543A probably damaging Het
Ranbp9 T C 13: 43,461,773 I190V possibly damaging Het
Slc1a4 C T 11: 20,306,467 V455M probably damaging Het
Srbd1 T A 17: 86,130,254 E220D probably benign Het
Thsd7a A G 6: 12,327,577 V1432A probably benign Het
Zfp61 T C 7: 24,293,354 R71G probably benign Het
Other mutations in Mdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Mdh1 APN 11 21557438 utr 3 prime probably benign
IGL02273:Mdh1 APN 11 21559786 missense probably benign 0.38
IGL03198:Mdh1 APN 11 21564168 missense probably damaging 1.00
PIT4480001:Mdh1 UTSW 11 21558538 missense probably damaging 1.00
R1016:Mdh1 UTSW 11 21559769 missense probably benign 0.01
R3854:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R3855:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R3886:Mdh1 UTSW 11 21559832 missense probably damaging 0.97
R4474:Mdh1 UTSW 11 21566624 missense possibly damaging 0.49
R4507:Mdh1 UTSW 11 21558470 missense probably benign 0.01
R4724:Mdh1 UTSW 11 21562957 missense probably damaging 1.00
R4986:Mdh1 UTSW 11 21558545 missense possibly damaging 0.85
R5472:Mdh1 UTSW 11 21559786 missense probably benign 0.38
R7088:Mdh1 UTSW 11 21558484 missense probably damaging 1.00
X0063:Mdh1 UTSW 11 21562870 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCCTCTGAAATTGATTGGGCTTCC -3'
(R):5'- TGTTCATCCAGGGCAGACTCACTC -3'

Sequencing Primer
(F):5'- CAGAGTCTGAGAGATTTTCACTTG -3'
(R):5'- TCGTCCCTAGTATGCAGGAGAC -3'
Posted On2013-10-16