Incidental Mutation 'R0771:Ncapg2'
ID76963
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
MMRRC Submission 038951-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0771 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 116413159 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 122 (C122*)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828] [ENSMUST00000221114] [ENSMUST00000221970] [ENSMUST00000222469]
Predicted Effect probably null
Transcript: ENSMUST00000084828
AA Change: C122*
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: C122*

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220608
Predicted Effect probably benign
Transcript: ENSMUST00000221114
Predicted Effect probably benign
Transcript: ENSMUST00000221970
Predicted Effect probably benign
Transcript: ENSMUST00000222469
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,683 E434G probably damaging Het
Adam19 G A 11: 46,121,453 V259I possibly damaging Het
Adam5 A G 8: 24,786,299 S451P probably benign Het
Chd6 G A 2: 161,019,580 L516F probably damaging Het
Elovl4 A G 9: 83,785,115 V154A possibly damaging Het
Gadl1 G A 9: 115,944,232 R114Q probably damaging Het
Gm5065 A G 7: 5,359,823 D151G probably damaging Het
Gm9733 T A 3: 15,320,446 Q132L probably benign Het
Ipo13 T C 4: 117,894,646 N936S possibly damaging Het
Kcnd2 T A 6: 21,216,442 S48R probably damaging Het
Lim2 C A 7: 43,430,703 A38E possibly damaging Het
Lrp2 A T 2: 69,507,990 D1177E probably damaging Het
Mdh1 C T 11: 21,557,550 V300I probably benign Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Myo10 A G 15: 25,778,178 Y114C probably damaging Het
Nod1 T G 6: 54,944,269 S355R probably damaging Het
Olfr1020 A T 2: 85,849,994 I181F possibly damaging Het
Olfr686 T A 7: 105,204,161 M61L possibly damaging Het
Pcsk1 A T 13: 75,132,162 E702V probably benign Het
Ptpn21 T C 12: 98,689,080 T543A probably damaging Het
Ranbp9 T C 13: 43,461,773 I190V possibly damaging Het
Slc1a4 C T 11: 20,306,467 V455M probably damaging Het
Srbd1 T A 17: 86,130,254 E220D probably benign Het
Thsd7a A G 6: 12,327,577 V1432A probably benign Het
Zfp61 T C 7: 24,293,354 R71G probably benign Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8132:Ncapg2 UTSW 12 116444347 missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACGATATGGAATCAGAGCACAGTCC -3'
(R):5'- ACAGAGCCTGGCTAACTCAAGGTG -3'

Sequencing Primer
(F):5'- cctggaactcacatgcaatac -3'
(R):5'- AAGGTGCCCTTGAGAACTTG -3'
Posted On2013-10-16