Incidental Mutation 'R0773:Rasl10b'
ID76974
Institutional Source Beutler Lab
Gene Symbol Rasl10b
Ensembl Gene ENSMUSG00000020684
Gene NameRAS-like, family 10, member B
SynonymsB230331P10Rik, VTS58635
MMRRC Submission 038953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0773 (G1)
Quality Score91
Status Not validated
Chromosome11
Chromosomal Location83409137-83421039 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 83417839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021022] [ENSMUST00000021022] [ENSMUST00000052521] [ENSMUST00000108140] [ENSMUST00000108140] [ENSMUST00000147301] [ENSMUST00000164425] [ENSMUST00000164425] [ENSMUST00000175848] [ENSMUST00000175848]
Predicted Effect probably null
Transcript: ENSMUST00000021022
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021022
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052521
SMART Domains Protein: ENSMUSP00000051907
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 200 N/A INTRINSIC
Pfam:GAS2 206 274 1.2e-35 PFAM
low complexity region 444 460 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108140
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108140
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147301
SMART Domains Protein: ENSMUSP00000119454
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164425
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164425
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.2%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have smaller than normal large dense-core vesicles in atrial myocytes and exhibit impaired atrial natriuretic peptide secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 1 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Other mutations in Rasl10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Rasl10b APN 11 83417853 missense probably damaging 1.00
R0378:Rasl10b UTSW 11 83418693 missense probably damaging 1.00
R0772:Rasl10b UTSW 11 83417839 splice site probably null
R0829:Rasl10b UTSW 11 83417839 splice site probably null
R0830:Rasl10b UTSW 11 83417839 splice site probably null
R0831:Rasl10b UTSW 11 83417839 splice site probably null
R1363:Rasl10b UTSW 11 83417839 splice site probably null
R1364:Rasl10b UTSW 11 83417839 splice site probably null
R1365:Rasl10b UTSW 11 83417839 splice site probably null
R1366:Rasl10b UTSW 11 83417839 splice site probably null
R1367:Rasl10b UTSW 11 83417839 splice site probably null
R1368:Rasl10b UTSW 11 83417839 splice site probably null
R1389:Rasl10b UTSW 11 83417839 splice site probably null
R3771:Rasl10b UTSW 11 83418523 missense probably benign 0.04
R4925:Rasl10b UTSW 11 83412679 missense probably damaging 1.00
R5625:Rasl10b UTSW 11 83418814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCACAAAATAGTGTGGTGGGC -3'
(R):5'- TGTACCCCTCTTTTGGAGACAGGC -3'

Sequencing Primer
(F):5'- CCAGGAAGTAACCAGCTTGTG -3'
(R):5'- TTTTGGAGACAGGCCAGCATC -3'
Posted On2013-10-16