Mutagenetix > Incidental Mutation

Incidental Mutation 'R0776:Cald1'

76987

Institutional Source

Beutler Lab

Gene Symbol

Cald1

Ensembl Gene

ENSMUSG00000029761

Gene Name

caldesmon 1

Synonyms

C920027I18Rik, 4833423D12Rik

MMRRC Submission

038956-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0776 (G1)

Quality Score

106

Status

Not validated

Chromosome

Chromosomal Location

34575433-34752404 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

AAGAGAGAGAGAGAG to AAGAGAGAGAGAG at 34723108 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031775] [ENSMUST00000079391] [ENSMUST00000115021] [ENSMUST00000115026] [ENSMUST00000115027] [ENSMUST00000126181] [ENSMUST00000142512] [ENSMUST00000149009]

AlphaFold

E9QA15

Predicted Effect

probably benign
Transcript: ENSMUST00000031775

SMART Domains

Protein: ENSMUSP00000031775
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
Pfam:Caldesmon	25	542	5.7e-256	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000079391

SMART Domains

Protein: ENSMUSP00000078362
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Caldesmon	31	522	4.3e-260	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115021

SMART Domains

Protein: ENSMUSP00000110673
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
Pfam:Caldesmon	25	518	7.5e-259	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115026

SMART Domains

Protein: ENSMUSP00000110678
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Caldesmon	31	524	4.9e-259	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115027

SMART Domains

Protein: ENSMUSP00000110679
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Caldesmon	31	363	8.4e-34	PFAM
Pfam:Caldesmon	243	755	3.8e-144	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123823

SMART Domains

Protein: ENSMUSP00000117064
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
Pfam:Caldesmon	1	210	4e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126181

SMART Domains

Protein: ENSMUSP00000121911
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
Pfam:Caldesmon	1	138	7.6e-51	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000136907

SMART Domains

Protein: ENSMUSP00000121213
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
Pfam:Caldesmon	50	354	4.6e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146685

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154182

Predicted Effect

probably benign
Transcript: ENSMUST00000142512

SMART Domains

Protein: ENSMUSP00000122926
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Caldesmon	31	253	9.4e-97	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149009

SMART Domains

Protein: ENSMUSP00000138368
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
Pfam:Caldesmon	25	507	2e-247	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142716

SMART Domains

Protein: ENSMUSP00000116247
Gene: ENSMUSG00000029761

Domain	Start	End	E-Value	Type
Pfam:Caldesmon	1	274	2.7e-63	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.0%
20x: 90.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Some homozygous mutant mice develop hernia and those that do, die within 5-7 hours after birth. Mice homozygous for a different targeted allele fail to develop. Mice heterozygous for this allele exhibit increased urinary bladder weight, smooth muscle bundles and non-voiding contractions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 3 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Muc4	C	G	16: 32,574,020 (GRCm39)	S699R	probably benign	Het
Rpgrip1	A	G	14: 52,378,626 (GRCm39)	D517G	possibly damaging	Het
Sis	T	C	3: 72,859,864 (GRCm39)	Q297R	probably damaging	Het

Other mutations in Cald1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01140:Cald1	APN	6	34,739,196 (GRCm39)	missense	possibly damaging	0.66
IGL01456:Cald1	APN	6	34,741,931 (GRCm39)	missense	probably damaging	1.00
IGL01822:Cald1	APN	6	34,730,507 (GRCm39)	missense	probably damaging	0.99
IGL01959:Cald1	APN	6	34,730,403 (GRCm39)	missense	probably damaging	1.00
IGL02307:Cald1	APN	6	34,730,390 (GRCm39)	missense	probably damaging	1.00
IGL03122:Cald1	APN	6	34,741,963 (GRCm39)	missense	probably damaging	1.00
R0060:Cald1	UTSW	6	34,692,394 (GRCm39)	intron	probably benign
R0071:Cald1	UTSW	6	34,735,069 (GRCm39)	splice site	probably benign
R0071:Cald1	UTSW	6	34,735,069 (GRCm39)	splice site	probably benign
R0701:Cald1	UTSW	6	34,723,108 (GRCm39)	frame shift	probably null
R1053:Cald1	UTSW	6	34,732,577 (GRCm39)	missense	probably damaging	1.00
R1696:Cald1	UTSW	6	34,722,646 (GRCm39)	missense	probably damaging	1.00
R2025:Cald1	UTSW	6	34,723,108 (GRCm39)	frame shift	probably null
R2157:Cald1	UTSW	6	34,662,976 (GRCm39)	missense	possibly damaging	0.86
R2973:Cald1	UTSW	6	34,734,931 (GRCm39)	unclassified	probably benign
R3839:Cald1	UTSW	6	34,722,700 (GRCm39)	missense	probably damaging	1.00
R4116:Cald1	UTSW	6	34,722,654 (GRCm39)	missense	probably damaging	1.00
R4674:Cald1	UTSW	6	34,723,108 (GRCm39)	frame shift	probably null
R5140:Cald1	UTSW	6	34,730,515 (GRCm39)	missense	probably damaging	1.00
R5254:Cald1	UTSW	6	34,723,351 (GRCm39)	intron	probably benign
R5620:Cald1	UTSW	6	34,739,047 (GRCm39)	missense	probably damaging	1.00
R5648:Cald1	UTSW	6	34,739,267 (GRCm39)	splice site	probably null
R5651:Cald1	UTSW	6	34,739,255 (GRCm39)	missense	probably damaging	0.98
R5783:Cald1	UTSW	6	34,730,468 (GRCm39)	missense	possibly damaging	0.51
R5872:Cald1	UTSW	6	34,748,043 (GRCm39)	nonsense	probably null
R5999:Cald1	UTSW	6	34,723,273 (GRCm39)	intron	probably benign
R6218:Cald1	UTSW	6	34,724,863 (GRCm39)	frame shift	probably null
R6347:Cald1	UTSW	6	34,741,981 (GRCm39)	missense	probably damaging	1.00
R6598:Cald1	UTSW	6	34,723,575 (GRCm39)	critical splice donor site	probably null
R7120:Cald1	UTSW	6	34,663,011 (GRCm39)	critical splice donor site	probably null
R7147:Cald1	UTSW	6	34,723,231 (GRCm39)	missense
R7385:Cald1	UTSW	6	34,663,000 (GRCm39)	missense	probably damaging	0.99
R7516:Cald1	UTSW	6	34,686,492 (GRCm39)	start gained	probably benign
R7841:Cald1	UTSW	6	34,722,696 (GRCm39)	missense	unknown
R8732:Cald1	UTSW	6	34,734,946 (GRCm39)	missense	unknown
R9151:Cald1	UTSW	6	34,732,682 (GRCm39)	missense	unknown
R9184:Cald1	UTSW	6	34,730,512 (GRCm39)	missense	unknown
R9529:Cald1	UTSW	6	34,662,947 (GRCm39)	missense	probably damaging	1.00
R9792:Cald1	UTSW	6	34,723,071 (GRCm39)	missense
R9793:Cald1	UTSW	6	34,723,071 (GRCm39)	missense
R9795:Cald1	UTSW	6	34,723,071 (GRCm39)	missense
X0064:Cald1	UTSW	6	34,723,140 (GRCm39)	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGTCATCAAGTCCTACCAGAAGAAC -3'
(R):5'- CACAGTGCTTACTGTACCTGCGTC -3'

Sequencing Primer
(F):5'- CAGCTATCAGGATGCTGAAGAC -3'
(R):5'- cctccctcctctctctctc -3'

Posted On

2013-10-16