Incidental Mutation 'R0847:Rprd2'
ID 76996
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Name regulation of nuclear pre-mRNA domain containing 2
Synonyms 2810036A19Rik, 6720469I21Rik, 4930535B03Rik
MMRRC Submission 039026-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.733) question?
Stock # R0847 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 95667653-95726175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95672725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 893 (S893P)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791]
AlphaFold Q6NXI6
Predicted Effect probably benign
Transcript: ENSMUST00000090791
AA Change: S893P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: S893P

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200164
AA Change: S809P
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,895,764 (GRCm39) I899T probably damaging Het
Ahnak C T 19: 8,983,797 (GRCm39) Q1694* probably null Het
Cblc A T 7: 19,524,459 (GRCm39) Y260* probably null Het
Ccn4 T G 15: 66,791,124 (GRCm39) C309G probably damaging Het
Ceacam5 A G 7: 17,491,762 (GRCm39) T711A possibly damaging Het
Cep63 A G 9: 102,465,957 (GRCm39) S690P probably benign Het
Chia1 A T 3: 106,039,253 (GRCm39) I448F probably benign Het
Dmxl2 A T 9: 54,313,112 (GRCm39) F1712I probably damaging Het
Ecpas G A 4: 58,841,439 (GRCm39) T645I probably benign Het
Exosc3 A G 4: 45,319,695 (GRCm39) V109A probably damaging Het
Fxyd7 A G 7: 30,744,029 (GRCm39) C60R probably damaging Het
Gm17349 C A 15: 99,600,289 (GRCm39) probably benign Het
Gpn2 A G 4: 133,315,906 (GRCm39) N199D probably benign Het
Ints12 C T 3: 132,814,603 (GRCm39) T270M possibly damaging Het
Kdm4a C T 4: 118,021,695 (GRCm39) E266K probably damaging Het
Kremen2 G T 17: 23,963,634 (GRCm39) T50N probably damaging Het
Macf1 A T 4: 123,293,159 (GRCm39) D1249E probably benign Het
Mdga2 T A 12: 66,769,854 (GRCm39) K146N probably damaging Het
Med20 G A 17: 47,922,618 (GRCm39) probably null Het
Myo18b T C 5: 113,022,354 (GRCm39) probably benign Het
Nav3 T A 10: 109,739,718 (GRCm39) T84S possibly damaging Het
Olfm2 A G 9: 20,579,953 (GRCm39) V266A probably damaging Het
Or5b101 A T 19: 13,005,095 (GRCm39) Y199* probably null Het
Or5b123 C T 19: 13,596,915 (GRCm39) H87Y probably benign Het
Or6c69b T A 10: 129,627,327 (GRCm39) I44F probably damaging Het
Pthlh A T 6: 147,164,766 (GRCm39) probably null Het
Rpap3 C T 15: 97,601,082 (GRCm39) probably null Het
Sacm1l G A 9: 123,377,927 (GRCm39) G69D probably damaging Het
Slc27a4 T C 2: 29,701,261 (GRCm39) S351P probably benign Het
Sobp C G 10: 42,898,415 (GRCm39) R390P probably damaging Het
Spata7 T A 12: 98,614,689 (GRCm39) M107K possibly damaging Het
Sri G A 5: 8,113,755 (GRCm39) probably null Het
Stab2 T C 10: 86,805,735 (GRCm39) I204V probably benign Het
Synm T C 7: 67,384,804 (GRCm39) I511V probably damaging Het
Tbr1 T C 2: 61,635,373 (GRCm39) S108P probably benign Het
Tln1 A G 4: 43,555,333 (GRCm39) F197S probably damaging Het
Tmem167b C T 3: 108,467,537 (GRCm39) G46R probably benign Het
Tmprss11g T C 5: 86,638,585 (GRCm39) K301R probably benign Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm2 C T 10: 77,765,122 (GRCm39) V960M possibly damaging Het
Ube3a G A 7: 58,926,334 (GRCm39) D371N possibly damaging Het
Vmn2r57 A T 7: 41,078,225 (GRCm39) F78I probably benign Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95,672,691 (GRCm39) missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95,672,421 (GRCm39) missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95,692,416 (GRCm39) missense probably benign 0.05
IGL01022:Rprd2 APN 3 95,671,066 (GRCm39) nonsense probably null
IGL01121:Rprd2 APN 3 95,683,862 (GRCm39) missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95,683,859 (GRCm39) missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95,672,631 (GRCm39) missense probably benign
IGL01414:Rprd2 APN 3 95,672,837 (GRCm39) missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95,672,815 (GRCm39) missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95,694,622 (GRCm39) missense probably benign 0.17
R0131:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95,681,669 (GRCm39) missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95,673,699 (GRCm39) missense probably benign 0.30
R0942:Rprd2 UTSW 3 95,672,730 (GRCm39) missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95,691,559 (GRCm39) missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95,673,216 (GRCm39) missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95,725,888 (GRCm39) missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95,672,988 (GRCm39) missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95,672,047 (GRCm39) missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95,726,051 (GRCm39) unclassified probably benign
R1640:Rprd2 UTSW 3 95,671,059 (GRCm39) unclassified probably benign
R1670:Rprd2 UTSW 3 95,672,115 (GRCm39) missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95,672,107 (GRCm39) nonsense probably null
R2966:Rprd2 UTSW 3 95,673,745 (GRCm39) splice site probably null
R3612:Rprd2 UTSW 3 95,671,464 (GRCm39) missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95,671,872 (GRCm39) missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95,672,536 (GRCm39) missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95,694,686 (GRCm39) missense probably benign 0.41
R4783:Rprd2 UTSW 3 95,681,645 (GRCm39) missense probably benign 0.03
R4832:Rprd2 UTSW 3 95,681,483 (GRCm39) missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95,671,849 (GRCm39) missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95,673,661 (GRCm39) missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95,672,632 (GRCm39) missense probably benign 0.03
R5134:Rprd2 UTSW 3 95,672,632 (GRCm39) missense probably benign 0.03
R5244:Rprd2 UTSW 3 95,697,494 (GRCm39) missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95,671,401 (GRCm39) missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95,692,371 (GRCm39) missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95,672,175 (GRCm39) missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95,694,685 (GRCm39) missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95,687,753 (GRCm39) missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95,673,399 (GRCm39) missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95,681,531 (GRCm39) missense probably benign 0.00
R7064:Rprd2 UTSW 3 95,672,328 (GRCm39) missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95,684,022 (GRCm39) missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95,673,087 (GRCm39) missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95,683,899 (GRCm39) missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95,684,105 (GRCm39) missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95,691,613 (GRCm39) missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95,671,367 (GRCm39) missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95,687,896 (GRCm39) missense probably damaging 0.99
R9030:Rprd2 UTSW 3 95,691,622 (GRCm39) missense probably benign 0.15
R9623:Rprd2 UTSW 3 95,679,505 (GRCm39) missense probably benign 0.30
RF034:Rprd2 UTSW 3 95,673,632 (GRCm39) small deletion probably benign
RF056:Rprd2 UTSW 3 95,673,631 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGATGCCCAGCAGTAGACTGAGAC -3'
(R):5'- TCCAGGAAGAGATGAAAGCTACCCC -3'

Sequencing Primer
(F):5'- ACAAGCCACTGTGGTTGG -3'
(R):5'- ATCACTGATGGACTCTTCACAGG -3'
Posted On 2013-10-16