Incidental Mutation 'R0847:Exosc3'
ID77001
Institutional Source Beutler Lab
Gene Symbol Exosc3
Ensembl Gene ENSMUSG00000028322
Gene Nameexosome component 3
Synonyms
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location45316613-45342732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45319695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000030003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030003] [ENSMUST00000044673] [ENSMUST00000107800]
Predicted Effect probably damaging
Transcript: ENSMUST00000030003
AA Change: V109A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030003
Gene: ENSMUSG00000028322
AA Change: V109A

DomainStartEndE-ValueType
Blast:S1 111 180 4e-36 BLAST
Pfam:KH_6 196 243 3.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044673
SMART Domains Protein: ENSMUSP00000041052
Gene: ENSMUSG00000035601

DomainStartEndE-ValueType
low complexity region 76 95 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
Pfam:tRNA_m1G_MT 135 308 2.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107800
SMART Domains Protein: ENSMUSP00000103429
Gene: ENSMUSG00000035601

DomainStartEndE-ValueType
low complexity region 76 95 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
Pfam:tRNA_m1G_MT 133 306 1.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145756
Predicted Effect unknown
Transcript: ENSMUST00000152056
AA Change: V21A
SMART Domains Protein: ENSMUSP00000115532
Gene: ENSMUSG00000028322
AA Change: V21A

DomainStartEndE-ValueType
Blast:S1 24 93 8e-38 BLAST
Pfam:KH_6 109 145 8e-13 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-catalytic component of the human exosome, a complex with 3'-5' exoribonuclease activity that plays a role in numerous RNA processing and degradation activities. Related pseudogenes of this gene are found on chromosome 19 and 21. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a conditional ready allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Exosc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Exosc3 APN 4 45317747 missense probably damaging 1.00
IGL01860:Exosc3 APN 4 45319659 missense probably benign
IGL02368:Exosc3 APN 4 45319671 missense probably damaging 1.00
IGL02370:Exosc3 APN 4 45319671 missense probably damaging 1.00
R0557:Exosc3 UTSW 4 45316957 missense probably damaging 1.00
R4161:Exosc3 UTSW 4 45320619 intron probably benign
R4723:Exosc3 UTSW 4 45319642 missense probably benign 0.01
R5010:Exosc3 UTSW 4 45317702 missense possibly damaging 0.60
R6929:Exosc3 UTSW 4 45320482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCAATACTTCTGGAGCCGC -3'
(R):5'- TGTGCCACCAGACTTGTAAAGGATG -3'

Sequencing Primer
(F):5'- GACAATTCAAGTAGCCCTCTGGATAG -3'
(R):5'- CCAGACTTGTAAAGGATGCTGAG -3'
Posted On2013-10-16