Incidental Mutation 'R0847:Wisp1'
ID77030
Institutional Source Beutler Lab
Gene Symbol Wisp1
Ensembl Gene ENSMUSG00000005124
Gene NameWNT1 inducible signaling pathway protein 1
SynonymsCCN4, Elm1
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location66891320-66923201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66919275 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 309 (C309G)
Ref Sequence ENSEMBL: ENSMUSP00000005255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005255] [ENSMUST00000118823] [ENSMUST00000147079]
Predicted Effect probably damaging
Transcript: ENSMUST00000005255
AA Change: C309G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005255
Gene: ENSMUSG00000005124
AA Change: C309G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 6.39e-13 SMART
VWC 123 185 5.63e-13 SMART
TSP1 217 260 4.34e-5 SMART
CT 278 347 1.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118823
SMART Domains Protein: ENSMUSP00000113144
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 3.19e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133863
Predicted Effect probably benign
Transcript: ENSMUST00000147079
SMART Domains Protein: ENSMUSP00000117402
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230535
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit impaired motor coordination during inverted screen testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Other mutations in Wisp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03051:Wisp1 APN 15 66906550 nonsense probably null
IGL03057:Wisp1 APN 15 66891640 splice site probably benign
R0029:Wisp1 UTSW 15 66912864 missense probably damaging 1.00
R0125:Wisp1 UTSW 15 66917345 missense possibly damaging 0.82
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0470:Wisp1 UTSW 15 66917378 missense probably benign 0.13
R1463:Wisp1 UTSW 15 66919271 missense possibly damaging 0.52
R1623:Wisp1 UTSW 15 66891599 missense possibly damaging 0.46
R1785:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R1786:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R2027:Wisp1 UTSW 15 66917409 missense possibly damaging 0.50
R2104:Wisp1 UTSW 15 66919327 missense probably benign 0.11
R2440:Wisp1 UTSW 15 66912857 missense possibly damaging 0.71
R3791:Wisp1 UTSW 15 66919288 missense probably damaging 1.00
R4748:Wisp1 UTSW 15 66906640 nonsense probably null
R5317:Wisp1 UTSW 15 66917282 missense probably benign
R6960:Wisp1 UTSW 15 66919198 missense probably benign 0.00
R7144:Wisp1 UTSW 15 66913030 missense probably damaging 0.99
R8237:Wisp1 UTSW 15 66919234 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAAGATGACGCCTGCCATGCAC -3'
(R):5'- CATGGAACTTTACCCTGAGCCACAC -3'

Sequencing Primer
(F):5'- CTGCCATGCACAATGATGGG -3'
(R):5'- CTGAGCCACACACCCAC -3'
Posted On2013-10-16