Incidental Mutation 'R0847:Rpap3'
ID77032
Institutional Source Beutler Lab
Gene Symbol Rpap3
Ensembl Gene ENSMUSG00000022466
Gene NameRNA polymerase II associated protein 3
Synonyms2310042P20Rik, D15Ertd682e
MMRRC Submission 039026-MU
Accession Numbers

Genbank: NM_028003; MGI: 1277218

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0847 (G1)
Quality Score198
Status Not validated
Chromosome15
Chromosomal Location97675097-97705825 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 97703201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023104]
Predicted Effect probably null
Transcript: ENSMUST00000023104
SMART Domains Protein: ENSMUSP00000023104
Gene: ENSMUSG00000022466

DomainStartEndE-ValueType
coiled coil region 9 45 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
TPR 134 167 1.12e-7 SMART
TPR 168 201 2.07e1 SMART
TPR 202 235 2.36e-6 SMART
low complexity region 252 273 N/A INTRINSIC
TPR 284 317 6.58e-5 SMART
TPR 318 351 4.45e-2 SMART
TPR 352 385 3.87e-2 SMART
Pfam:RPAP3_C 540 631 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(10) : Targeted, other(1) Gene trapped(9)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Rpap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Rpap3 APN 15 97703239 missense possibly damaging 0.85
IGL02714:Rpap3 APN 15 97696577 missense possibly damaging 0.93
IGL03409:Rpap3 APN 15 97681739 missense possibly damaging 0.46
R0095:Rpap3 UTSW 15 97680536 splice site probably benign
R1496:Rpap3 UTSW 15 97686483 missense possibly damaging 0.86
R1562:Rpap3 UTSW 15 97694217 missense possibly damaging 0.86
R1603:Rpap3 UTSW 15 97701121 missense possibly damaging 0.53
R1801:Rpap3 UTSW 15 97694209 missense possibly damaging 0.73
R2163:Rpap3 UTSW 15 97680348 missense possibly damaging 0.71
R4969:Rpap3 UTSW 15 97686526 missense probably benign
R5226:Rpap3 UTSW 15 97703223 missense possibly damaging 0.53
R6610:Rpap3 UTSW 15 97688168 missense probably benign 0.24
R6613:Rpap3 UTSW 15 97681841 critical splice acceptor site probably null
R7040:Rpap3 UTSW 15 97679112 missense possibly damaging 0.51
R7429:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7430:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7829:Rpap3 UTSW 15 97681708 missense probably benign 0.02
R7853:Rpap3 UTSW 15 97678418 missense possibly damaging 0.92
R8223:Rpap3 UTSW 15 97691304 missense probably benign 0.02
R8366:Rpap3 UTSW 15 97681667 missense probably benign 0.18
YA93:Rpap3 UTSW 15 97693233 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTCGACAGCACATTTTACAGGGC -3'
(R):5'- ACTTGGCAGGACACGATGACTTC -3'

Sequencing Primer
(F):5'- cgattcctggagcccac -3'
(R):5'- TGACTTCGGCGAGTAAGGC -3'
Posted On2013-10-16