Incidental Mutation 'R0849:Cntn2'
ID77042
Institutional Source Beutler Lab
Gene Symbol Cntn2
Ensembl Gene ENSMUSG00000053024
Gene Namecontactin 2
Synonymsaxonin, Tax, TAG-1, D130012K04Rik
MMRRC Submission 039028-MU
Accession Numbers

Ncbi RefSeq: NM_177129.5; MGI:104518

Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132509427-132543256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132522386 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 590 (M590K)
Ref Sequence ENSEMBL: ENSMUSP00000083707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086521]
Predicted Effect probably benign
Transcript: ENSMUST00000086521
AA Change: M590K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024
AA Change: M590K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect unknown
Transcript: ENSMUST00000188065
AA Change: M93K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype Strain: 2181052; 2677610; 3521785
FUNCTION: This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. Mice lacking a functional copy of this gene exhibit epileptic seizures and elevated expression of A1 adenosine receptors. [provided by RefSeq, Sep 2016]
PHENOTYPE: Targeted mutation of this locus results in molecular abnormalities in the central nervous system. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Cntn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Cntn2 APN 1 132521884 splice site probably benign
IGL01137:Cntn2 APN 1 132521297 splice site probably benign
IGL01339:Cntn2 APN 1 132518905 splice site probably null
IGL01369:Cntn2 APN 1 132516105 missense probably benign
IGL01572:Cntn2 APN 1 132528171 missense probably damaging 1.00
IGL02389:Cntn2 APN 1 132525321 missense probably damaging 0.99
IGL02473:Cntn2 APN 1 132518331 missense probably benign
IGL02550:Cntn2 APN 1 132529063 missense probably null 0.03
IGL02608:Cntn2 APN 1 132525916 missense possibly damaging 0.87
IGL02755:Cntn2 APN 1 132529302 missense probably benign 0.43
IGL02850:Cntn2 APN 1 132518376 missense probably benign 0.00
IGL02887:Cntn2 APN 1 132516570 missense probably damaging 0.96
IGL03060:Cntn2 APN 1 132528940 missense probably benign 0.03
IGL03224:Cntn2 APN 1 132523042 missense probably damaging 1.00
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0270:Cntn2 UTSW 1 132521724 missense probably damaging 1.00
R0739:Cntn2 UTSW 1 132529012 missense probably damaging 1.00
R0903:Cntn2 UTSW 1 132533684 small deletion probably benign
R1463:Cntn2 UTSW 1 132521137 critical splice donor site probably null
R1512:Cntn2 UTSW 1 132523692 missense probably damaging 0.99
R1535:Cntn2 UTSW 1 132525384 missense probably benign 0.26
R1686:Cntn2 UTSW 1 132526311 missense possibly damaging 0.78
R1696:Cntn2 UTSW 1 132521279 missense probably damaging 0.96
R1708:Cntn2 UTSW 1 132519198 missense probably damaging 0.96
R2251:Cntn2 UTSW 1 132525321 missense probably damaging 0.99
R2315:Cntn2 UTSW 1 132522997 missense probably benign 0.00
R2395:Cntn2 UTSW 1 132526372 missense probably benign
R3617:Cntn2 UTSW 1 132528623 missense probably benign 0.16
R3883:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R3884:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R4060:Cntn2 UTSW 1 132525896 missense probably damaging 0.99
R4289:Cntn2 UTSW 1 132527743 missense probably benign 0.01
R4710:Cntn2 UTSW 1 132528225 missense possibly damaging 0.84
R4921:Cntn2 UTSW 1 132516032 missense possibly damaging 0.49
R5121:Cntn2 UTSW 1 132517060 nonsense probably null
R5288:Cntn2 UTSW 1 132523677 missense probably benign 0.18
R5360:Cntn2 UTSW 1 132518857 missense probably damaging 0.97
R5787:Cntn2 UTSW 1 132523059 missense probably damaging 1.00
R5817:Cntn2 UTSW 1 132518748 missense probably benign 0.21
R5930:Cntn2 UTSW 1 132523432 missense probably damaging 1.00
R6053:Cntn2 UTSW 1 132518352 missense probably benign 0.18
R7189:Cntn2 UTSW 1 132517086 missense probably damaging 1.00
R7352:Cntn2 UTSW 1 132522399 missense probably benign 0.02
R7562:Cntn2 UTSW 1 132526317 missense possibly damaging 0.67
R7689:Cntn2 UTSW 1 132516144 missense probably benign 0.00
R7764:Cntn2 UTSW 1 132522363 missense probably benign 0.21
X0018:Cntn2 UTSW 1 132533684 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAAGCATCTCAGACTTGGTGGCTC -3'
(R):5'- AGGCTCCATTTCGTCTTGTGGC -3'

Sequencing Primer
(F):5'- GGCTTTGGAAGACATAGTCTACTC -3'
(R):5'- GGCCTATTACACTAGTCAGGG -3'
Posted On2013-10-16