Mutagenetix > Incidental Mutations

Incidental Mutation 'R0849:Kcnt2'

77044

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

039028-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R0849 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140507762 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 496 (V496A)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060201
AA Change: V496A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000054623
Gene: ENSMUSG00000052726
AA Change: V496A

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	424	533	1.3e-31	PFAM
low complexity region	655	670	N/A	INTRINSIC
low complexity region	677	689	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119786

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120709
AA Change: V489A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: V489A

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120796
AA Change: V489A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: V489A

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145077

SMART Domains

Protein: ENSMUSP00000123677
Gene: ENSMUSG00000052726

Domain	Start	End	E-Value	Type
Pfam:BK_channel_a	1	88	1.2e-23	PFAM
low complexity region	209	224	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.5%
20x: 92.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	C	9: 103,263,057	Y488D	possibly damaging	Het
Arhgap5	T	C	12: 52,519,623	F1126L	probably benign	Het
Arhgef11	G	T	3: 87,735,896	A1472S	probably benign	Het
Armc9	G	A	1: 86,257,270	R681K	probably benign	Het
Atxn2	T	A	5: 121,747,421		probably null	Het
B3gnt6	C	A	7: 98,194,743	L3F	probably benign	Het
Cand2	A	G	6: 115,792,391	T721A	probably damaging	Het
Cntn2	A	T	1: 132,522,386	M590K	probably benign	Het
Cntn4	A	T	6: 106,667,457	D622V	probably damaging	Het
Des	T	G	1: 75,360,628	S71A	probably benign	Het
Dnah5	C	A	15: 28,263,599	R827S	probably damaging	Het
Dstn	G	A	2: 143,938,535	G52S	probably benign	Het
Eln	T	A	5: 134,707,981	R704*	probably null	Het
Fezf2	T	A	14: 12,342,607	K419N	probably damaging	Het
Gm2381	G	A	7: 42,819,948	Q251*	probably null	Het
Gm9268	A	G	7: 43,024,718	Y400C	probably damaging	Het
Grin3a	G	A	4: 49,665,501	R1045*	probably null	Het
Herc2	T	A	7: 56,206,578	H3921Q	probably damaging	Het
Hs3st2	A	G	7: 121,501,032	E367G	possibly damaging	Het
Hydin	G	A	8: 110,598,984	R4675H	probably damaging	Het
Irf2bp1	T	C	7: 19,004,734	S100P	possibly damaging	Het
Itga10	A	G	3: 96,652,530	I500M	possibly damaging	Het
Mansc1	T	C	6: 134,610,707	D169G	probably benign	Het
Mdn1	T	A	4: 32,741,835	S3869T	probably damaging	Het
Mrgprb4	G	A	7: 48,199,120	T20I	probably benign	Het
Nek4	A	G	14: 30,957,296	E198G	probably damaging	Het
Olfr1120	G	T	2: 87,358,265	V274L	probably benign	Het
Olfr1131	C	A	2: 87,629,282	T273K	possibly damaging	Het
Olfr1380	G	A	11: 49,564,302	C127Y	probably damaging	Het
Ppfia4	A	T	1: 134,319,372	F537I	probably benign	Het
Rarb	A	G	14: 16,434,293	V295A	probably damaging	Het
Ryr1	A	G	7: 29,040,679	S3941P	probably damaging	Het
Scnn1b	A	G	7: 121,912,475	N370S	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Sv2c	C	T	13: 95,989,811	G311D	probably damaging	Het
Tas2r109	T	C	6: 132,980,893	I25V	probably benign	Het
Tbcel	A	C	9: 42,437,157	I305S	probably damaging	Het
Tmem35b	A	G	4: 127,126,197		probably null	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Tmtc4	A	G	14: 122,945,554	I244T	possibly damaging	Het
Usp9y	C	A	Y: 1,394,002	C576F	probably damaging	Het
Vcan	A	T	13: 89,704,953	N629K	possibly damaging	Het
Vmn2r22	T	C	6: 123,637,404	Y409C	probably damaging	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- GGCTACCTCCTTGAATTGTGTCTACTG -3'
(R):5'- AGTCAGCAAGATTAGCCTTGTCCAC -3'

Sequencing Primer
(F):5'- CCTTGAATTGTGTCTACTGCTTTTTG -3'
(R):5'- GCTTAAAAAGTCTAAACGTATGAGCG -3'

Posted On

2013-10-16