Incidental Mutation 'R0849:Kcnt2'
ID 77044
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Name potassium channel, subfamily T, member 2
Synonyms E330038N15Rik
MMRRC Submission 039028-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R0849 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 140173896-140539805 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140435500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 496 (V496A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
AlphaFold D3Z649
Predicted Effect probably damaging
Transcript: ENSMUST00000060201
AA Change: V496A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054623
Gene: ENSMUSG00000052726
AA Change: V496A

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 424 533 1.3e-31 PFAM
low complexity region 655 670 N/A INTRINSIC
low complexity region 677 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119786
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120709
AA Change: V489A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: V489A

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120796
AA Change: V489A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: V489A

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145077
SMART Domains Protein: ENSMUSP00000123677
Gene: ENSMUSG00000052726

DomainStartEndE-ValueType
Pfam:BK_channel_a 1 88 1.2e-23 PFAM
low complexity region 209 224 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 T C 12: 52,566,406 (GRCm39) F1126L probably benign Het
Arhgef11 G T 3: 87,643,203 (GRCm39) A1472S probably benign Het
Armc9 G A 1: 86,184,992 (GRCm39) R681K probably benign Het
Atxn2 T A 5: 121,885,484 (GRCm39) probably null Het
B3gnt6 C A 7: 97,843,950 (GRCm39) L3F probably benign Het
Cand2 A G 6: 115,769,352 (GRCm39) T721A probably damaging Het
Cntn2 A T 1: 132,450,124 (GRCm39) M590K probably benign Het
Cntn4 A T 6: 106,644,418 (GRCm39) D622V probably damaging Het
Des T G 1: 75,337,272 (GRCm39) S71A probably benign Het
Dnah5 C A 15: 28,263,745 (GRCm39) R827S probably damaging Het
Dstn G A 2: 143,780,455 (GRCm39) G52S probably benign Het
Eln T A 5: 134,736,835 (GRCm39) R704* probably null Het
Fezf2 T A 14: 12,342,607 (GRCm38) K419N probably damaging Het
Gm2381 G A 7: 42,469,372 (GRCm39) Q251* probably null Het
Grin3a G A 4: 49,665,501 (GRCm39) R1045* probably null Het
Herc2 T A 7: 55,856,326 (GRCm39) H3921Q probably damaging Het
Hs3st2 A G 7: 121,100,255 (GRCm39) E367G possibly damaging Het
Hydin G A 8: 111,325,616 (GRCm39) R4675H probably damaging Het
Inhca A C 9: 103,140,256 (GRCm39) Y488D possibly damaging Het
Irf2bp1 T C 7: 18,738,659 (GRCm39) S100P possibly damaging Het
Itga10 A G 3: 96,559,846 (GRCm39) I500M possibly damaging Het
Mansc1 T C 6: 134,587,670 (GRCm39) D169G probably benign Het
Mdn1 T A 4: 32,741,835 (GRCm39) S3869T probably damaging Het
Mrgprb4 G A 7: 47,848,868 (GRCm39) T20I probably benign Het
Nek4 A G 14: 30,679,253 (GRCm39) E198G probably damaging Het
Or12e8 G T 2: 87,188,609 (GRCm39) V274L probably benign Het
Or2y10 G A 11: 49,455,129 (GRCm39) C127Y probably damaging Het
Or5w11 C A 2: 87,459,626 (GRCm39) T273K possibly damaging Het
Ppfia4 A T 1: 134,247,110 (GRCm39) F537I probably benign Het
Rarb A G 14: 16,434,293 (GRCm38) V295A probably damaging Het
Ryr1 A G 7: 28,740,104 (GRCm39) S3941P probably damaging Het
Scnn1b A G 7: 121,511,698 (GRCm39) N370S probably damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Sv2c C T 13: 96,126,319 (GRCm39) G311D probably damaging Het
Tas2r109 T C 6: 132,957,856 (GRCm39) I25V probably benign Het
Tbcel A C 9: 42,348,453 (GRCm39) I305S probably damaging Het
Tmem35b A G 4: 127,019,990 (GRCm39) probably null Het
Tmem38b T C 4: 53,840,765 (GRCm39) L60S probably damaging Het
Tmtc4 A G 14: 123,182,966 (GRCm39) I244T possibly damaging Het
Usp9y C A Y: 1,394,002 (GRCm39) C576F probably damaging Het
Vcan A T 13: 89,853,072 (GRCm39) N629K possibly damaging Het
Vmn2r22 T C 6: 123,614,363 (GRCm39) Y409C probably damaging Het
Vmn2r-ps158 A G 7: 42,674,142 (GRCm39) Y400C probably damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140,450,836 (GRCm39) missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140,523,789 (GRCm39) missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140,450,949 (GRCm39) missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140,282,293 (GRCm39) critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140,498,155 (GRCm39) missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140,523,736 (GRCm39) missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140,304,121 (GRCm39) missense probably benign
IGL02350:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02483:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02866:Kcnt2 APN 1 140,352,986 (GRCm39) missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140,502,544 (GRCm39) missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140,282,245 (GRCm39) missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140,498,193 (GRCm39) missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140,461,740 (GRCm39) intron probably benign
BB002:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
BB012:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R0230:Kcnt2 UTSW 1 140,174,083 (GRCm39) missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140,278,963 (GRCm39) missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140,437,218 (GRCm39) nonsense probably null
R0543:Kcnt2 UTSW 1 140,537,352 (GRCm39) missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140,501,346 (GRCm39) missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140,356,593 (GRCm39) missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140,310,766 (GRCm39) missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140,411,970 (GRCm39) nonsense probably null
R1546:Kcnt2 UTSW 1 140,359,116 (GRCm39) missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140,353,068 (GRCm39) missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140,511,985 (GRCm39) missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140,512,031 (GRCm39) missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140,353,079 (GRCm39) missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140,480,756 (GRCm39) missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140,302,892 (GRCm39) missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140,480,701 (GRCm39) missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140,356,551 (GRCm39) missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140,437,179 (GRCm39) missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140,458,538 (GRCm39) missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140,501,421 (GRCm39) splice site probably null
R2442:Kcnt2 UTSW 1 140,304,091 (GRCm39) missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140,356,622 (GRCm39) missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140,461,706 (GRCm39) missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140,512,025 (GRCm39) missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140,537,368 (GRCm39) missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140,353,070 (GRCm39) missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140,480,718 (GRCm39) missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140,435,485 (GRCm39) missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140,450,886 (GRCm39) missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140,446,635 (GRCm39) missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140,282,254 (GRCm39) missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140,440,763 (GRCm39) nonsense probably null
R4973:Kcnt2 UTSW 1 140,537,388 (GRCm39) missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140,278,994 (GRCm39) missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140,537,353 (GRCm39) missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140,354,639 (GRCm39) missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140,502,481 (GRCm39) missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140,437,234 (GRCm39) missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140,353,104 (GRCm39) missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140,461,666 (GRCm39) missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140,435,440 (GRCm39) missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140,290,718 (GRCm39) missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140,354,661 (GRCm39) nonsense probably null
R6248:Kcnt2 UTSW 1 140,437,216 (GRCm39) missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140,302,850 (GRCm39) missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140,437,322 (GRCm39) missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140,511,844 (GRCm39) missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140,278,965 (GRCm39) missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140,173,931 (GRCm39) unclassified probably benign
R6856:Kcnt2 UTSW 1 140,523,742 (GRCm39) missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140,511,803 (GRCm39) missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140,440,646 (GRCm39) missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140,310,785 (GRCm39) missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140,523,778 (GRCm39) missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140,282,255 (GRCm39) missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140,498,216 (GRCm39) missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140,511,793 (GRCm39) missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140,304,122 (GRCm39) missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140,450,928 (GRCm39) missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140,498,199 (GRCm39) missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140,446,686 (GRCm39) missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140,501,385 (GRCm39) missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140,450,888 (GRCm39) missense probably damaging 0.99
R7925:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R8040:Kcnt2 UTSW 1 140,377,955 (GRCm39) missense probably damaging 1.00
R8041:Kcnt2 UTSW 1 140,537,398 (GRCm39) missense probably benign
R8171:Kcnt2 UTSW 1 140,437,203 (GRCm39) missense probably benign 0.13
R8268:Kcnt2 UTSW 1 140,450,954 (GRCm39) missense probably damaging 0.99
R8905:Kcnt2 UTSW 1 140,435,467 (GRCm39) missense possibly damaging 0.65
R8927:Kcnt2 UTSW 1 140,356,535 (GRCm39) splice site probably null
R8988:Kcnt2 UTSW 1 140,356,587 (GRCm39) missense probably benign 0.38
R9020:Kcnt2 UTSW 1 140,512,049 (GRCm39) missense probably benign 0.23
R9109:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9167:Kcnt2 UTSW 1 140,506,200 (GRCm39) missense probably benign 0.11
R9232:Kcnt2 UTSW 1 140,411,931 (GRCm39) missense possibly damaging 0.56
R9297:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9298:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9318:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9404:Kcnt2 UTSW 1 140,353,107 (GRCm39) missense probably damaging 1.00
X0062:Kcnt2 UTSW 1 140,440,729 (GRCm39) missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140,511,896 (GRCm39) nonsense probably null
Z1088:Kcnt2 UTSW 1 140,501,384 (GRCm39) missense probably damaging 1.00
Z1176:Kcnt2 UTSW 1 140,304,099 (GRCm39) missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140,537,386 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GGCTACCTCCTTGAATTGTGTCTACTG -3'
(R):5'- AGTCAGCAAGATTAGCCTTGTCCAC -3'

Sequencing Primer
(F):5'- CCTTGAATTGTGTCTACTGCTTTTTG -3'
(R):5'- GCTTAAAAAGTCTAAACGTATGAGCG -3'
Posted On 2013-10-16