Incidental Mutation 'R0849:Olfr1131'
ID77047
Institutional Source Beutler Lab
Gene Symbol Olfr1131
Ensembl Gene ENSMUSG00000068819
Gene Nameolfactory receptor 1131
SynonymsGA_x6K02T2Q125-49133664-49134593, MOR177-4
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87627104-87630203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87629282 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 273 (T273K)
Ref Sequence ENSEMBL: ENSMUSP00000150754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090712] [ENSMUST00000213302] [ENSMUST00000216082] [ENSMUST00000216756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090712
AA Change: T273K

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088214
Gene: ENSMUSG00000068819
AA Change: T273K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-47 PFAM
Pfam:7tm_1 40 289 1.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213302
AA Change: T273K

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000216082
Predicted Effect probably benign
Transcript: ENSMUST00000216756
AA Change: T157K

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Olfr1131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr1131 APN 2 87628629 missense probably benign 0.03
IGL02186:Olfr1131 APN 2 87629371 missense probably benign 0.00
R0266:Olfr1131 UTSW 2 87629282 missense possibly damaging 0.79
R1607:Olfr1131 UTSW 2 87628977 missense probably benign 0.14
R2077:Olfr1131 UTSW 2 87628829 missense probably damaging 1.00
R2105:Olfr1131 UTSW 2 87628939 missense probably benign 0.20
R2322:Olfr1131 UTSW 2 87628774 missense possibly damaging 0.86
R3434:Olfr1131 UTSW 2 87629074 missense probably benign 0.02
R4357:Olfr1131 UTSW 2 87628466 start codon destroyed probably null 1.00
R5139:Olfr1131 UTSW 2 87628656 missense probably benign 0.03
R5333:Olfr1131 UTSW 2 87629114 missense probably damaging 0.97
R5719:Olfr1131 UTSW 2 87629131 unclassified probably null
R6449:Olfr1131 UTSW 2 87629149 missense possibly damaging 0.63
R7640:Olfr1131 UTSW 2 87629092 missense probably benign 0.01
X0027:Olfr1131 UTSW 2 87629303 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCGGGTCTAATGAGATCAACCAC -3'
(R):5'- TGCCAGCCAGGAAAACATAGCG -3'

Sequencing Primer
(F):5'- TTGAACTGAGCACCATCTCAGG -3'
(R):5'- cagccaggaaaacatagcGAATAG -3'
Posted On2013-10-16