Incidental Mutation 'R0849:Dstn'
ID77049
Institutional Source Beutler Lab
Gene Symbol Dstn
Ensembl Gene ENSMUSG00000015932
Gene Namedestrin
Synonymssid23p, ADF, corn1, 2610043P17Rik
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location143915320-143943324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143938535 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 52 (G52S)
Ref Sequence ENSEMBL: ENSMUSP00000099461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103172]
Predicted Effect probably benign
Transcript: ENSMUST00000103172
AA Change: G52S

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099461
Gene: ENSMUSG00000015932
AA Change: G52S

DomainStartEndE-ValueType
ADF 19 153 2.67e-52 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying mutations at this locus develop irregular thickening of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Dstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Dstn APN 2 143942174 missense probably benign
R0655:Dstn UTSW 2 143938422 missense probably damaging 1.00
R1405:Dstn UTSW 2 143938436 missense probably damaging 1.00
R1405:Dstn UTSW 2 143938436 missense probably damaging 1.00
R1460:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R1541:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R3882:Dstn UTSW 2 143942187 missense probably benign 0.20
R6419:Dstn UTSW 2 143939987 missense possibly damaging 0.75
R7402:Dstn UTSW 2 143938448 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAATCTGTAGCCAAAATGCAGTG -3'
(R):5'- TCCTAGTGCTCACCACAGGAAGAAC -3'

Sequencing Primer
(F):5'- AGAGTTGTAAGCTCTTTTGCAC -3'
(R):5'- GAAGAACATCAGCTCTTCTTTCCTG -3'
Posted On2013-10-16