Mutagenetix > Incidental Mutation

Incidental Mutation 'R0849:Itga10'

77052

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

039028-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R0849 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96652530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 500 (I500M)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029744
AA Change: I500M

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: I500M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119365
AA Change: I500M

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: I500M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127607

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.5%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	C	9: 103,263,057	Y488D	possibly damaging	Het
Arhgap5	T	C	12: 52,519,623	F1126L	probably benign	Het
Arhgef11	G	T	3: 87,735,896	A1472S	probably benign	Het
Armc9	G	A	1: 86,257,270	R681K	probably benign	Het
Atxn2	T	A	5: 121,747,421		probably null	Het
B3gnt6	C	A	7: 98,194,743	L3F	probably benign	Het
Cand2	A	G	6: 115,792,391	T721A	probably damaging	Het
Cntn2	A	T	1: 132,522,386	M590K	probably benign	Het
Cntn4	A	T	6: 106,667,457	D622V	probably damaging	Het
Des	T	G	1: 75,360,628	S71A	probably benign	Het
Dnah5	C	A	15: 28,263,599	R827S	probably damaging	Het
Dstn	G	A	2: 143,938,535	G52S	probably benign	Het
Eln	T	A	5: 134,707,981	R704*	probably null	Het
Fezf2	T	A	14: 12,342,607	K419N	probably damaging	Het
Gm2381	G	A	7: 42,819,948	Q251*	probably null	Het
Gm9268	A	G	7: 43,024,718	Y400C	probably damaging	Het
Grin3a	G	A	4: 49,665,501	R1045*	probably null	Het
Herc2	T	A	7: 56,206,578	H3921Q	probably damaging	Het
Hs3st2	A	G	7: 121,501,032	E367G	possibly damaging	Het
Hydin	G	A	8: 110,598,984	R4675H	probably damaging	Het
Irf2bp1	T	C	7: 19,004,734	S100P	possibly damaging	Het
Kcnt2	T	C	1: 140,507,762	V496A	probably damaging	Het
Mansc1	T	C	6: 134,610,707	D169G	probably benign	Het
Mdn1	T	A	4: 32,741,835	S3869T	probably damaging	Het
Mrgprb4	G	A	7: 48,199,120	T20I	probably benign	Het
Nek4	A	G	14: 30,957,296	E198G	probably damaging	Het
Olfr1120	G	T	2: 87,358,265	V274L	probably benign	Het
Olfr1131	C	A	2: 87,629,282	T273K	possibly damaging	Het
Olfr1380	G	A	11: 49,564,302	C127Y	probably damaging	Het
Ppfia4	A	T	1: 134,319,372	F537I	probably benign	Het
Rarb	A	G	14: 16,434,293	V295A	probably damaging	Het
Ryr1	A	G	7: 29,040,679	S3941P	probably damaging	Het
Scnn1b	A	G	7: 121,912,475	N370S	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Sv2c	C	T	13: 95,989,811	G311D	probably damaging	Het
Tas2r109	T	C	6: 132,980,893	I25V	probably benign	Het
Tbcel	A	C	9: 42,437,157	I305S	probably damaging	Het
Tmem35b	A	G	4: 127,126,197		probably null	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Tmtc4	A	G	14: 122,945,554	I244T	possibly damaging	Het
Usp9y	C	A	Y: 1,394,002	C576F	probably damaging	Het
Vcan	A	T	13: 89,704,953	N629K	possibly damaging	Het
Vmn2r22	T	C	6: 123,637,404	Y409C	probably damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCCTTATGCCTTCAGGAAACCCTC -3'
(R):5'- AAGCTCTCAAATATGTGTGCCTCCC -3'

Sequencing Primer
(F):5'- cccccCAGGGACTGGAC -3'
(R):5'- AAATATGTGTGCCTCCCTCTTC -3'

Posted On

2013-10-16