Incidental Mutation 'R0849:Irf2bp1'
ID77065
Institutional Source Beutler Lab
Gene Symbol Irf2bp1
Ensembl Gene ENSMUSG00000044030
Gene Nameinterferon regulatory factor 2 binding protein 1
Synonyms
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.527) question?
Stock #R0849 (G1)
Quality Score214
Status Not validated
Chromosome7
Chromosomal Location19004044-19006777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19004734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 100 (S100P)
Ref Sequence ENSEMBL: ENSMUSP00000061234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053713] [ENSMUST00000059331] [ENSMUST00000131087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053713
AA Change: S100P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061234
Gene: ENSMUSG00000044030
AA Change: S100P

DomainStartEndE-ValueType
Pfam:IRF-2BP1_2 8 59 9.5e-37 PFAM
low complexity region 82 105 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
low complexity region 441 458 N/A INTRINSIC
low complexity region 481 500 N/A INTRINSIC
Pfam:zf-C3HC4 503 549 1.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059331
SMART Domains Protein: ENSMUSP00000058718
Gene: ENSMUSG00000048481

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
SANT 20 90 4.06e-5 SMART
low complexity region 125 157 N/A INTRINSIC
low complexity region 212 250 N/A INTRINSIC
low complexity region 278 322 N/A INTRINSIC
low complexity region 323 347 N/A INTRINSIC
low complexity region 358 374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124897
Predicted Effect probably benign
Transcript: ENSMUST00000131087
SMART Domains Protein: ENSMUSP00000117357
Gene: ENSMUSG00000048481

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
SANT 20 90 4.06e-5 SMART
low complexity region 125 157 N/A INTRINSIC
low complexity region 212 250 N/A INTRINSIC
low complexity region 278 322 N/A INTRINSIC
low complexity region 323 347 N/A INTRINSIC
low complexity region 358 374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206381
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Irf2bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Irf2bp1 APN 7 19006027 missense possibly damaging 0.86
IGL01983:Irf2bp1 APN 7 19005295 missense possibly damaging 0.70
R0063:Irf2bp1 UTSW 7 19005847 missense possibly damaging 0.91
R0255:Irf2bp1 UTSW 7 19005002 missense possibly damaging 0.91
R2250:Irf2bp1 UTSW 7 19005799 missense probably benign 0.12
R3972:Irf2bp1 UTSW 7 19005444 missense possibly damaging 0.70
R4703:Irf2bp1 UTSW 7 19005571 missense possibly damaging 0.91
R5290:Irf2bp1 UTSW 7 19004998 missense possibly damaging 0.85
R5729:Irf2bp1 UTSW 7 19005247 nonsense probably null
R5902:Irf2bp1 UTSW 7 19004447 missense probably benign 0.07
R6874:Irf2bp1 UTSW 7 19005217 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TACCTGTGCGACCTGCCCAAGATG -3'
(R):5'- GCTTCTCCTTCTCGAAATCGGAGCC -3'

Sequencing Primer
(F):5'- ACTTCAGCGAGGCTGTG -3'
(R):5'- TTAAGCCAGGTGCCAGC -3'
Posted On2013-10-16