Incidental Mutation 'R0849:Gm9268'
ID77068
Institutional Source Beutler Lab
Gene Symbol Gm9268
Ensembl Gene ENSMUSG00000091528
Gene Namepredicted gene 9268
Synonyms
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0849 (G1)
Quality Score181
Status Not validated
Chromosome7
Chromosomal Location43018798-43048106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43024718 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 400 (Y400C)
Ref Sequence ENSEMBL: ENSMUSP00000134441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166914] [ENSMUST00000173815]
Predicted Effect probably damaging
Transcript: ENSMUST00000166914
AA Change: Y407C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129068
Gene: ENSMUSG00000091528
AA Change: Y407C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 473 1.1e-41 PFAM
Pfam:NCD3G 516 569 1.7e-23 PFAM
Pfam:7tm_3 602 837 9.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173815
AA Change: Y400C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134441
Gene: ENSMUSG00000091528
AA Change: Y400C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 5.3e-40 PFAM
Pfam:NCD3G 509 562 4.6e-22 PFAM
Pfam:7tm_3 594 831 1.1e-73 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Gm9268
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Gm9268 APN 7 43024709 missense probably damaging 0.97
IGL01753:Gm9268 APN 7 43024715 missense probably damaging 1.00
IGL02338:Gm9268 APN 7 43047736 missense probably damaging 1.00
IGL02541:Gm9268 APN 7 43023668 splice site probably benign
R0751:Gm9268 UTSW 7 43047409 missense probably damaging 0.99
R1460:Gm9268 UTSW 7 43023215 missense probably benign 0.25
R1617:Gm9268 UTSW 7 43024079 missense probably benign 0.18
R1962:Gm9268 UTSW 7 43047400 missense probably benign 0.00
R1999:Gm9268 UTSW 7 43047459 missense probably damaging 1.00
R2022:Gm9268 UTSW 7 43024030 missense probably benign
R2434:Gm9268 UTSW 7 43047457 missense probably damaging 0.99
R3760:Gm9268 UTSW 7 43024078 missense probably benign 0.00
R4562:Gm9268 UTSW 7 43023562 nonsense probably null
R4890:Gm9268 UTSW 7 43047600 missense probably damaging 1.00
R5221:Gm9268 UTSW 7 43023260 missense probably benign 0.31
R5597:Gm9268 UTSW 7 43024649 missense probably benign 0.01
R6589:Gm9268 UTSW 7 43023598 missense possibly damaging 0.91
R6831:Gm9268 UTSW 7 43023580 missense probably damaging 1.00
R6834:Gm9268 UTSW 7 43023580 missense probably damaging 1.00
R6910:Gm9268 UTSW 7 43024051 missense probably benign 0.01
R6944:Gm9268 UTSW 7 43047969 missense possibly damaging 0.95
R7470:Gm9268 UTSW 7 43047886 missense probably damaging 1.00
R7553:Gm9268 UTSW 7 43048023 missense probably damaging 1.00
R7661:Gm9268 UTSW 7 43023158 missense probably benign 0.00
R7677:Gm9268 UTSW 7 43024739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATGGAAAGTCTGGGTCTTGAAC -3'
(R):5'- GCGTCTGCTCTGAGGAATATAAATGGG -3'

Sequencing Primer
(F):5'- AAGTCTGGGTCTTGAACTCTCAATG -3'
(R):5'- GTGAAACAGATATTCTCTTGCTTGC -3'
Posted On2013-10-16