Incidental Mutation 'R0849:Mrgprb4'
ID77070
Institutional Source Beutler Lab
Gene Symbol Mrgprb4
Ensembl Gene ENSMUSG00000070550
Gene NameMAS-related GPR, member B4
SynonymsMrgB4
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48198070-48199288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48199120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 20 (T20I)
Ref Sequence ENSEMBL: ENSMUSP00000091952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094388]
Predicted Effect probably benign
Transcript: ENSMUST00000094388
AA Change: T20I

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091952
Gene: ENSMUSG00000070550
AA Change: T20I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 37 215 6.4e-8 PFAM
Pfam:7tm_1 46 274 7.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal with no apparent alterations in the pattern of axonal innervation of the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Mrgprb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Mrgprb4 APN 7 48198901 missense probably benign
IGL02745:Mrgprb4 APN 7 48198358 missense probably damaging 0.97
R0718:Mrgprb4 UTSW 7 48198553 missense probably benign 0.10
R1526:Mrgprb4 UTSW 7 48198411 nonsense probably null
R2857:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R2859:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R4355:Mrgprb4 UTSW 7 48198701 missense possibly damaging 0.63
R5354:Mrgprb4 UTSW 7 48198329 missense probably benign 0.07
R5636:Mrgprb4 UTSW 7 48198470 missense probably benign 0.02
R5715:Mrgprb4 UTSW 7 48199039 missense probably damaging 1.00
R6180:Mrgprb4 UTSW 7 48198826 missense probably damaging 1.00
R6277:Mrgprb4 UTSW 7 48198901 missense probably benign
R7092:Mrgprb4 UTSW 7 48198236 missense probably benign 0.01
R7301:Mrgprb4 UTSW 7 48198758 missense probably damaging 0.99
R7779:Mrgprb4 UTSW 7 48199147 missense probably benign 0.19
Z1088:Mrgprb4 UTSW 7 48198682 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGAAATCAGCACCAGCCAGATTGAG -3'
(R):5'- GCAAGTACCATTCCCTTCGTGACTC -3'

Sequencing Primer
(F):5'- CCAGCCAGATTGAGGACATAGAC -3'
(R):5'- CCTGAAATGCTTAGCGACTG -3'
Posted On2013-10-16