Incidental Mutation 'R0849:B3gnt6'
ID77073
Institutional Source Beutler Lab
Gene Symbol B3gnt6
Ensembl Gene ENSMUSG00000074004
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Synonyms
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98192417-98199481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98194743 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 3 (L3F)
Ref Sequence ENSEMBL: ENSMUSP00000095879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098278]
Predicted Effect probably benign
Transcript: ENSMUST00000098278
AA Change: L3F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095879
Gene: ENSMUSG00000074004
AA Change: L3F

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Galactosyl_T 126 322 1.1e-48 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a beta-1,3-N-acetylglucosaminyltransferase that adds an N-acetylglucosamine moiety to N-acetylgalactosamine-modified serine or threonine. The encoded enzyme is responsible for creating the core 3 structure of O-glycans, which are important components of mucin-type glycoproteins. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozgous for a knock-out allele exhibit increased permeability of the intestinal barrier, increased susceptibility to DSS-induced colitis and accelerated colorectal tumorigenesis in mice treated with AOM and DSS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in B3gnt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:B3gnt6 APN 7 98194523 missense probably damaging 1.00
IGL02104:B3gnt6 APN 7 98194101 missense probably damaging 1.00
R0631:B3gnt6 UTSW 7 98193692 missense probably benign 0.02
R1015:B3gnt6 UTSW 7 98194595 missense probably benign 0.00
R2034:B3gnt6 UTSW 7 98194018 missense possibly damaging 0.92
R2915:B3gnt6 UTSW 7 98193593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCCAGTCAGGAGGTTCG -3'
(R):5'- GCTTGGGAGACCTAAGACGTTCAC -3'

Sequencing Primer
(F):5'- GGGGCACCTGGAAGAGC -3'
(R):5'- gcctgagccaccctatcc -3'
Posted On2013-10-16