Incidental Mutation 'R0849:Scnn1b'
ID77076
Institutional Source Beutler Lab
Gene Symbol Scnn1b
Ensembl Gene ENSMUSG00000030873
Gene Namesodium channel, nonvoltage-gated 1 beta
SynonymsENaC beta
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location121865038-121918514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121912475 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 370 (N370S)
Ref Sequence ENSEMBL: ENSMUSP00000145900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033161] [ENSMUST00000205438] [ENSMUST00000205520] [ENSMUST00000206079]
Predicted Effect probably damaging
Transcript: ENSMUST00000033161
AA Change: N370S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033161
Gene: ENSMUSG00000030873
AA Change: N370S

DomainStartEndE-ValueType
Pfam:ASC 29 541 2.4e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205438
Predicted Effect probably damaging
Transcript: ENSMUST00000205520
AA Change: N370S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206079
Meta Mutation Damage Score 0.3829 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the beta subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), and Liddle syndrome. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, decreased serum sodium levels but higher urine sodium levels and increased serum potassium and chloride levels but lower potassium urine levels. Another homozygous mutation exhibits no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Scnn1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Scnn1b APN 7 121918036 missense probably damaging 1.00
IGL01108:Scnn1b APN 7 121914332 splice site probably null
IGL02191:Scnn1b APN 7 121917513 missense probably damaging 1.00
IGL02197:Scnn1b APN 7 121902890 missense probably null 0.89
IGL02355:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02362:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02554:Scnn1b APN 7 121917523 missense probably damaging 1.00
IGL02834:Scnn1b APN 7 121912062 missense probably damaging 1.00
R0266:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R0494:Scnn1b UTSW 7 121899458 missense probably damaging 1.00
R0872:Scnn1b UTSW 7 121914330 critical splice donor site probably null
R0899:Scnn1b UTSW 7 121917715 missense probably damaging 1.00
R1386:Scnn1b UTSW 7 121902488 missense possibly damaging 0.60
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1662:Scnn1b UTSW 7 121902328 missense probably benign 0.00
R1782:Scnn1b UTSW 7 121917961 missense probably benign
R1829:Scnn1b UTSW 7 121902845 missense probably benign 0.00
R1861:Scnn1b UTSW 7 121914261 missense probably damaging 1.00
R1928:Scnn1b UTSW 7 121910447 missense probably damaging 1.00
R4016:Scnn1b UTSW 7 121914332 splice site probably null
R4192:Scnn1b UTSW 7 121902739 missense possibly damaging 0.63
R4504:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R4745:Scnn1b UTSW 7 121902286 missense probably benign 0.03
R4888:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R4941:Scnn1b UTSW 7 121912008 missense probably damaging 1.00
R5121:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R6379:Scnn1b UTSW 7 121915328 missense probably benign 0.10
R6516:Scnn1b UTSW 7 121912112 missense probably damaging 1.00
R6650:Scnn1b UTSW 7 121902820 missense probably damaging 0.97
R6730:Scnn1b UTSW 7 121902877 missense probably damaging 1.00
R7151:Scnn1b UTSW 7 121917886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCTTCCAGCACTTGCAAAC -3'
(R):5'- TCTTCCCAGGGAACATCTGCCAAC -3'

Sequencing Primer
(F):5'- AAACTCCCCAGCCCTTTG -3'
(R):5'- cccaagcaccacttacaaaac -3'
Posted On2013-10-16