Incidental Mutation 'R0849:Olfr1380'
ID77083
Institutional Source Beutler Lab
Gene Symbol Olfr1380
Ensembl Gene ENSMUSG00000107645
Gene Nameolfactory receptor 1380
SynonymsMOR256-66_i, GA_x6K02T2QP88-5871967-5871032
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49556878-49565859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49564302 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 127 (C127Y)
Ref Sequence ENSEMBL: ENSMUSP00000151039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204300] [ENSMUST00000215360]
Predicted Effect probably damaging
Transcript: ENSMUST00000071426
AA Change: C127Y

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071373
Gene: ENSMUSG00000091308
AA Change: C127Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.4e-47 PFAM
Pfam:7tm_1 41 289 9.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204300
AA Change: C127Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145428
Gene: ENSMUSG00000107645
AA Change: C127Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.4e-47 PFAM
Pfam:7tm_1 41 289 9.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215360
AA Change: C127Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Olfr1380
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr1380 APN 11 49563920 utr 5 prime probably benign
IGL01354:Olfr1380 APN 11 49564197 missense probably damaging 0.99
R0183:Olfr1380 UTSW 11 49564848 missense probably benign 0.14
R3855:Olfr1380 UTSW 11 49564091 missense probably damaging 0.98
R3904:Olfr1380 UTSW 11 49564758 missense possibly damaging 0.50
R4598:Olfr1380 UTSW 11 49564718 missense probably damaging 1.00
R4599:Olfr1380 UTSW 11 49564718 missense probably damaging 1.00
R5089:Olfr1380 UTSW 11 49564413 missense possibly damaging 0.94
R6029:Olfr1380 UTSW 11 49564601 missense possibly damaging 0.94
R6551:Olfr1380 UTSW 11 49563989 missense probably benign
R6953:Olfr1380 UTSW 11 49564290 missense probably damaging 1.00
R7223:Olfr1380 UTSW 11 49564098 missense probably damaging 0.99
R7343:Olfr1380 UTSW 11 49564502 missense possibly damaging 0.91
R7725:Olfr1380 UTSW 11 49564532 missense probably benign 0.01
R7762:Olfr1380 UTSW 11 49564761 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGACTCTCTTTGGCAACACCGTG -3'
(R):5'- AGGCCATCTTCAGGAGAACAGGTAG -3'

Sequencing Primer
(F):5'- GATCATCATCCTGTCTCAACTGG -3'
(R):5'- CTTCAGGAGAACAGGTAGCTCAC -3'
Posted On2013-10-16