Incidental Mutation 'R0849:Sv2c'
ID 77087
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 039028-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R0849 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 96126319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 311 (G311D)
Ref Sequence ENSEMBL: ENSMUSP00000124473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably damaging
Transcript: ENSMUST00000161263
AA Change: G311D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: G311D

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably damaging
Transcript: ENSMUST00000182289
AA Change: G311D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: G311D

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 T C 12: 52,566,406 (GRCm39) F1126L probably benign Het
Arhgef11 G T 3: 87,643,203 (GRCm39) A1472S probably benign Het
Armc9 G A 1: 86,184,992 (GRCm39) R681K probably benign Het
Atxn2 T A 5: 121,885,484 (GRCm39) probably null Het
B3gnt6 C A 7: 97,843,950 (GRCm39) L3F probably benign Het
Cand2 A G 6: 115,769,352 (GRCm39) T721A probably damaging Het
Cntn2 A T 1: 132,450,124 (GRCm39) M590K probably benign Het
Cntn4 A T 6: 106,644,418 (GRCm39) D622V probably damaging Het
Des T G 1: 75,337,272 (GRCm39) S71A probably benign Het
Dnah5 C A 15: 28,263,745 (GRCm39) R827S probably damaging Het
Dstn G A 2: 143,780,455 (GRCm39) G52S probably benign Het
Eln T A 5: 134,736,835 (GRCm39) R704* probably null Het
Fezf2 T A 14: 12,342,607 (GRCm38) K419N probably damaging Het
Gm2381 G A 7: 42,469,372 (GRCm39) Q251* probably null Het
Grin3a G A 4: 49,665,501 (GRCm39) R1045* probably null Het
Herc2 T A 7: 55,856,326 (GRCm39) H3921Q probably damaging Het
Hs3st2 A G 7: 121,100,255 (GRCm39) E367G possibly damaging Het
Hydin G A 8: 111,325,616 (GRCm39) R4675H probably damaging Het
Inhca A C 9: 103,140,256 (GRCm39) Y488D possibly damaging Het
Irf2bp1 T C 7: 18,738,659 (GRCm39) S100P possibly damaging Het
Itga10 A G 3: 96,559,846 (GRCm39) I500M possibly damaging Het
Kcnt2 T C 1: 140,435,500 (GRCm39) V496A probably damaging Het
Mansc1 T C 6: 134,587,670 (GRCm39) D169G probably benign Het
Mdn1 T A 4: 32,741,835 (GRCm39) S3869T probably damaging Het
Mrgprb4 G A 7: 47,848,868 (GRCm39) T20I probably benign Het
Nek4 A G 14: 30,679,253 (GRCm39) E198G probably damaging Het
Or12e8 G T 2: 87,188,609 (GRCm39) V274L probably benign Het
Or2y10 G A 11: 49,455,129 (GRCm39) C127Y probably damaging Het
Or5w11 C A 2: 87,459,626 (GRCm39) T273K possibly damaging Het
Ppfia4 A T 1: 134,247,110 (GRCm39) F537I probably benign Het
Rarb A G 14: 16,434,293 (GRCm38) V295A probably damaging Het
Ryr1 A G 7: 28,740,104 (GRCm39) S3941P probably damaging Het
Scnn1b A G 7: 121,511,698 (GRCm39) N370S probably damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Tas2r109 T C 6: 132,957,856 (GRCm39) I25V probably benign Het
Tbcel A C 9: 42,348,453 (GRCm39) I305S probably damaging Het
Tmem35b A G 4: 127,019,990 (GRCm39) probably null Het
Tmem38b T C 4: 53,840,765 (GRCm39) L60S probably damaging Het
Tmtc4 A G 14: 123,182,966 (GRCm39) I244T possibly damaging Het
Usp9y C A Y: 1,394,002 (GRCm39) C576F probably damaging Het
Vcan A T 13: 89,853,072 (GRCm39) N629K possibly damaging Het
Vmn2r22 T C 6: 123,614,363 (GRCm39) Y409C probably damaging Het
Vmn2r-ps158 A G 7: 42,674,142 (GRCm39) Y400C probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAACAGCAAGGAAGCCTTTCCAG -3'
(R):5'- CGCACGTACCCCATGCTTAGATTG -3'

Sequencing Primer
(F):5'- CCAGTGTACGTcccccc -3'
(R):5'- TCACCACTGCCCATGATGATG -3'
Posted On 2013-10-16