Mutagenetix > Incidental Mutations

Incidental Mutation 'R0849:Sv2c'

77087

Institutional Source

Beutler Lab

Gene Symbol

Sv2c

Ensembl Gene

ENSMUSG00000051111

Gene Name

synaptic vesicle glycoprotein 2c

Synonyms

4930527L09Rik

MMRRC Submission

039028-MU

Accession Numbers

Genbank: NM_029210; MGI: 1922459

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R0849 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95954594-96132577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 95989811 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 311 (G311D)

Ref Sequence

ENSEMBL: ENSMUSP00000124473 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]

Predicted Effect

probably damaging
Transcript: ENSMUST00000161263
AA Change: G311D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: G311D

Domain	Start	End	E-Value	Type
low complexity region	51	61	N/A	INTRINSIC
Pfam:Sugar_tr	117	428	9.1e-31	PFAM
Pfam:MFS_1	154	470	5e-27	PFAM
Pfam:Pentapeptide_4	496	573	4.8e-12	PFAM
Pfam:MFS_1	564	725	1.5e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182180

Predicted Effect

probably damaging
Transcript: ENSMUST00000182289
AA Change: G311D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: G311D

Domain	Start	End	E-Value	Type
low complexity region	51	61	N/A	INTRINSIC
Pfam:Sugar_tr	119	427	2.2e-30	PFAM
Pfam:MFS_1	154	470	5e-27	PFAM
Pfam:Pentapeptide_4	496	571	6.2e-15	PFAM
transmembrane domain	581	603	N/A	INTRINSIC
transmembrane domain	610	632	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220740

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.5%
20x: 92.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	C	9: 103,263,057	Y488D	possibly damaging	Het
Arhgap5	T	C	12: 52,519,623	F1126L	probably benign	Het
Arhgef11	G	T	3: 87,735,896	A1472S	probably benign	Het
Armc9	G	A	1: 86,257,270	R681K	probably benign	Het
Atxn2	T	A	5: 121,747,421		probably null	Het
B3gnt6	C	A	7: 98,194,743	L3F	probably benign	Het
Cand2	A	G	6: 115,792,391	T721A	probably damaging	Het
Cntn2	A	T	1: 132,522,386	M590K	probably benign	Het
Cntn4	A	T	6: 106,667,457	D622V	probably damaging	Het
Des	T	G	1: 75,360,628	S71A	probably benign	Het
Dnah5	C	A	15: 28,263,599	R827S	probably damaging	Het
Dstn	G	A	2: 143,938,535	G52S	probably benign	Het
Eln	T	A	5: 134,707,981	R704*	probably null	Het
Fezf2	T	A	14: 12,342,607	K419N	probably damaging	Het
Gm2381	G	A	7: 42,819,948	Q251*	probably null	Het
Gm9268	A	G	7: 43,024,718	Y400C	probably damaging	Het
Grin3a	G	A	4: 49,665,501	R1045*	probably null	Het
Herc2	T	A	7: 56,206,578	H3921Q	probably damaging	Het
Hs3st2	A	G	7: 121,501,032	E367G	possibly damaging	Het
Hydin	G	A	8: 110,598,984	R4675H	probably damaging	Het
Irf2bp1	T	C	7: 19,004,734	S100P	possibly damaging	Het
Itga10	A	G	3: 96,652,530	I500M	possibly damaging	Het
Kcnt2	T	C	1: 140,507,762	V496A	probably damaging	Het
Mansc1	T	C	6: 134,610,707	D169G	probably benign	Het
Mdn1	T	A	4: 32,741,835	S3869T	probably damaging	Het
Mrgprb4	G	A	7: 48,199,120	T20I	probably benign	Het
Nek4	A	G	14: 30,957,296	E198G	probably damaging	Het
Olfr1120	G	T	2: 87,358,265	V274L	probably benign	Het
Olfr1131	C	A	2: 87,629,282	T273K	possibly damaging	Het
Olfr1380	G	A	11: 49,564,302	C127Y	probably damaging	Het
Ppfia4	A	T	1: 134,319,372	F537I	probably benign	Het
Rarb	A	G	14: 16,434,293	V295A	probably damaging	Het
Ryr1	A	G	7: 29,040,679	S3941P	probably damaging	Het
Scnn1b	A	G	7: 121,912,475	N370S	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Tas2r109	T	C	6: 132,980,893	I25V	probably benign	Het
Tbcel	A	C	9: 42,437,157	I305S	probably damaging	Het
Tmem35b	A	G	4: 127,126,197		probably null	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Tmtc4	A	G	14: 122,945,554	I244T	possibly damaging	Het
Usp9y	C	A	Y: 1,394,002	C576F	probably damaging	Het
Vcan	A	T	13: 89,704,953	N629K	possibly damaging	Het
Vmn2r22	T	C	6: 123,637,404	Y409C	probably damaging	Het

Other mutations in Sv2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Sv2c	APN	13	96048429	missense	probably damaging	1.00
IGL01313:Sv2c	APN	13	96088289	missense	probably damaging	1.00
IGL02710:Sv2c	APN	13	95989141	missense	probably damaging	0.99
IGL02990:Sv2c	APN	13	96088378	missense	probably damaging	1.00
IGL03145:Sv2c	APN	13	95989098	missense	probably damaging	1.00
D4043:Sv2c	UTSW	13	96088481	missense	probably benign	0.27
R0390:Sv2c	UTSW	13	96088708	missense	probably benign
R0907:Sv2c	UTSW	13	96088255	missense	probably damaging	1.00
R1177:Sv2c	UTSW	13	95989763	missense	possibly damaging	0.79
R1840:Sv2c	UTSW	13	95981844	missense	probably benign	0.08
R1865:Sv2c	UTSW	13	95976775	missense	probably benign	0.29
R1959:Sv2c	UTSW	13	95976645	missense	probably damaging	1.00
R2440:Sv2c	UTSW	13	96048576	missense	probably damaging	1.00
R4007:Sv2c	UTSW	13	95986833	splice site	probably benign
R4197:Sv2c	UTSW	13	95978128	missense	probably damaging	1.00
R4697:Sv2c	UTSW	13	95986018	missense	possibly damaging	0.64
R4719:Sv2c	UTSW	13	95986811	missense	probably benign	0.21
R4822:Sv2c	UTSW	13	95985949	missense	probably damaging	1.00
R5237:Sv2c	UTSW	13	95981883	missense	possibly damaging	0.76
R5452:Sv2c	UTSW	13	95978083	missense	probably damaging	1.00
R5531:Sv2c	UTSW	13	95961378	missense	probably damaging	0.98
R5756:Sv2c	UTSW	13	95985967	missense	probably benign
R5982:Sv2c	UTSW	13	95976063	nonsense	probably null
R6220:Sv2c	UTSW	13	95976626	missense	probably damaging	1.00
R6511:Sv2c	UTSW	13	96048525	missense	probably benign	0.00
R6520:Sv2c	UTSW	13	95986721	missense	probably benign
R7001:Sv2c	UTSW	13	95981953	missense	probably benign	0.11
R7073:Sv2c	UTSW	13	96088250	missense	probably damaging	1.00
R7116:Sv2c	UTSW	13	95976644	missense	probably damaging	1.00
R7261:Sv2c	UTSW	13	96088301	missense	probably damaging	1.00
R7374:Sv2c	UTSW	13	95989136	missense	probably damaging	1.00
R7423:Sv2c	UTSW	13	96048548	missense	probably benign	0.03
R7626:Sv2c	UTSW	13	95985943	missense	probably benign	0.13
R7727:Sv2c	UTSW	13	95976695	missense	possibly damaging	0.89
R7767:Sv2c	UTSW	13	95989715	missense	probably damaging	1.00
R7818:Sv2c	UTSW	13	95986820	nonsense	probably null
R7831:Sv2c	UTSW	13	95976692	missense	probably damaging	1.00
R7991:Sv2c	UTSW	13	96088289	missense	probably damaging	1.00
R8137:Sv2c	UTSW	13	96088663	missense	probably damaging	0.96
R8254:Sv2c	UTSW	13	96088565	missense	probably damaging	1.00
Z1176:Sv2c	UTSW	13	95976097	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAACAGCAAGGAAGCCTTTCCAG -3'
(R):5'- CGCACGTACCCCATGCTTAGATTG -3'

Sequencing Primer
(F):5'- CCAGTGTACGTcccccc -3'
(R):5'- TCACCACTGCCCATGATGATG -3'

Posted On

2013-10-16