Incidental Mutation 'R0849:Fezf2'
ID77088
Institutional Source Beutler Lab
Gene Symbol Fezf2
Ensembl Gene ENSMUSG00000021743
Gene NameFez family zinc finger 2
SynonymsFezl, Zfp312, forebrain embryonic zinc finger, Fez
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location12342094-12348189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12342607 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 419 (K419N)
Ref Sequence ENSEMBL: ENSMUSP00000153090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022262] [ENSMUST00000224023] [ENSMUST00000224714]
Predicted Effect probably damaging
Transcript: ENSMUST00000022262
AA Change: K419N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022262
Gene: ENSMUSG00000021743
AA Change: K419N

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
ZnF_C2H2 272 294 1.58e-3 SMART
ZnF_C2H2 300 322 3.39e-3 SMART
ZnF_C2H2 328 350 2.79e-4 SMART
ZnF_C2H2 356 378 2.57e-3 SMART
ZnF_C2H2 384 406 1.45e-2 SMART
ZnF_C2H2 412 435 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224023
Predicted Effect probably damaging
Transcript: ENSMUST00000224714
AA Change: K419N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6390 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show hyperactivity, altered feeding behavior leading to delayed growth and premature death, and impaired formation of subplate neurons and thalamocortical projections. Homozygotes for another allele lack a corpus callosum and show severe subcortical projection defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Fezf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Fezf2 APN 14 12342498 makesense probably null
IGL02008:Fezf2 APN 14 12343705 missense probably benign 0.01
IGL02238:Fezf2 APN 14 12344494 missense probably damaging 0.98
IGL02428:Fezf2 APN 14 12344494 missense probably damaging 0.98
IGL02588:Fezf2 APN 14 12343687 missense probably damaging 1.00
K3955:Fezf2 UTSW 14 12345097 missense probably damaging 1.00
R0266:Fezf2 UTSW 14 12342607 missense probably damaging 1.00
R0281:Fezf2 UTSW 14 12343977 missense probably damaging 1.00
R1061:Fezf2 UTSW 14 12342713 missense probably damaging 1.00
R1107:Fezf2 UTSW 14 12342624 missense probably damaging 1.00
R1326:Fezf2 UTSW 14 12342644 missense probably benign 0.12
R1914:Fezf2 UTSW 14 12343988 missense probably damaging 1.00
R1955:Fezf2 UTSW 14 12342644 missense probably benign 0.12
R1980:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1981:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1982:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1988:Fezf2 UTSW 14 12344350 missense probably damaging 0.98
R4023:Fezf2 UTSW 14 12343986 missense probably damaging 1.00
R4025:Fezf2 UTSW 14 12343986 missense probably damaging 1.00
R4026:Fezf2 UTSW 14 12343986 missense probably damaging 1.00
R5373:Fezf2 UTSW 14 12344803 missense possibly damaging 0.67
R6982:Fezf2 UTSW 14 12343645 missense probably damaging 1.00
R7650:Fezf2 UTSW 14 12342653 missense probably damaging 0.97
R7677:Fezf2 UTSW 14 12344941 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATCGAGGACACGTTTACATTTCCCC -3'
(R):5'- CAAGCATCGCCTTCTGAGCTACTG -3'

Sequencing Primer
(F):5'- CCCCAAAAATATGCTGGTTTCG -3'
(R):5'- GGGGAGGTCTTATTCCACTACAAAC -3'
Posted On2013-10-16