Mutagenetix > Incidental Mutations

Incidental Mutation 'R0849:Rarb'

77089

Institutional Source

Beutler Lab

Gene Symbol

Rarb

Ensembl Gene

ENSMUSG00000017491

Gene Name

retinoic acid receptor, beta

Synonyms

RAR beta 2, Hap, RARbeta2

MMRRC Submission

039028-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0849 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16430839-16819156 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16434293 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 295 (V295A)

Ref Sequence

ENSEMBL: ENSMUSP00000152980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000225921]

Predicted Effect

probably benign
Transcript: ENSMUST00000017629

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063750
AA Change: V341A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491
AA Change: V341A

Domain	Start	End	E-Value	Type
low complexity region	52	75	N/A	INTRINSIC
ZnF_C4	78	149	3.77e-40	SMART
HOLI	223	381	1.72e-34	SMART
low complexity region	428	445	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223576

Predicted Effect

probably damaging
Transcript: ENSMUST00000225921
AA Change: V295A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.5%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	C	9: 103,263,057	Y488D	possibly damaging	Het
Arhgap5	T	C	12: 52,519,623	F1126L	probably benign	Het
Arhgef11	G	T	3: 87,735,896	A1472S	probably benign	Het
Armc9	G	A	1: 86,257,270	R681K	probably benign	Het
Atxn2	T	A	5: 121,747,421		probably null	Het
B3gnt6	C	A	7: 98,194,743	L3F	probably benign	Het
Cand2	A	G	6: 115,792,391	T721A	probably damaging	Het
Cntn2	A	T	1: 132,522,386	M590K	probably benign	Het
Cntn4	A	T	6: 106,667,457	D622V	probably damaging	Het
Des	T	G	1: 75,360,628	S71A	probably benign	Het
Dnah5	C	A	15: 28,263,599	R827S	probably damaging	Het
Dstn	G	A	2: 143,938,535	G52S	probably benign	Het
Eln	T	A	5: 134,707,981	R704*	probably null	Het
Fezf2	T	A	14: 12,342,607	K419N	probably damaging	Het
Gm2381	G	A	7: 42,819,948	Q251*	probably null	Het
Gm9268	A	G	7: 43,024,718	Y400C	probably damaging	Het
Grin3a	G	A	4: 49,665,501	R1045*	probably null	Het
Herc2	T	A	7: 56,206,578	H3921Q	probably damaging	Het
Hs3st2	A	G	7: 121,501,032	E367G	possibly damaging	Het
Hydin	G	A	8: 110,598,984	R4675H	probably damaging	Het
Irf2bp1	T	C	7: 19,004,734	S100P	possibly damaging	Het
Itga10	A	G	3: 96,652,530	I500M	possibly damaging	Het
Kcnt2	T	C	1: 140,507,762	V496A	probably damaging	Het
Mansc1	T	C	6: 134,610,707	D169G	probably benign	Het
Mdn1	T	A	4: 32,741,835	S3869T	probably damaging	Het
Mrgprb4	G	A	7: 48,199,120	T20I	probably benign	Het
Nek4	A	G	14: 30,957,296	E198G	probably damaging	Het
Olfr1120	G	T	2: 87,358,265	V274L	probably benign	Het
Olfr1131	C	A	2: 87,629,282	T273K	possibly damaging	Het
Olfr1380	G	A	11: 49,564,302	C127Y	probably damaging	Het
Ppfia4	A	T	1: 134,319,372	F537I	probably benign	Het
Ryr1	A	G	7: 29,040,679	S3941P	probably damaging	Het
Scnn1b	A	G	7: 121,912,475	N370S	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Sv2c	C	T	13: 95,989,811	G311D	probably damaging	Het
Tas2r109	T	C	6: 132,980,893	I25V	probably benign	Het
Tbcel	A	C	9: 42,437,157	I305S	probably damaging	Het
Tmem35b	A	G	4: 127,126,197		probably null	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Tmtc4	A	G	14: 122,945,554	I244T	possibly damaging	Het
Usp9y	C	A	Y: 1,394,002	C576F	probably damaging	Het
Vcan	A	T	13: 89,704,953	N629K	possibly damaging	Het
Vmn2r22	T	C	6: 123,637,404	Y409C	probably damaging	Het

Other mutations in Rarb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00756:Rarb	APN	14	16443791	nonsense	probably null
IGL01483:Rarb	APN	14	16432273	splice site	probably benign
IGL01591:Rarb	APN	14	16434207	missense	possibly damaging	0.93
IGL01769:Rarb	APN	14	16443760	missense	probably damaging	0.97
IGL01782:Rarb	APN	14	16434180	missense	probably damaging	1.00
IGL01866:Rarb	APN	14	16443751	missense	probably benign	0.17
IGL03299:Rarb	APN	14	16434168	missense	probably damaging	1.00
IGL03134:Rarb	UTSW	14	16436910	missense	probably damaging	0.99
R0055:Rarb	UTSW	14	16509066	missense	probably damaging	1.00
R0055:Rarb	UTSW	14	16509066	missense	probably damaging	1.00
R1067:Rarb	UTSW	14	16436769	missense	probably damaging	0.98
R1314:Rarb	UTSW	14	16508932	critical splice donor site	probably null
R1416:Rarb	UTSW	14	16435177	missense	possibly damaging	0.82
R2894:Rarb	UTSW	14	16435146	missense	probably damaging	1.00
R4637:Rarb	UTSW	14	16574875	missense	possibly damaging	0.51
R4950:Rarb	UTSW	14	16432085	unclassified	probably benign
R5420:Rarb	UTSW	14	16434249	missense	possibly damaging	0.89
R5456:Rarb	UTSW	14	16436843	missense	probably damaging	1.00
R5635:Rarb	UTSW	14	16443788	missense	probably damaging	1.00
R5689:Rarb	UTSW	14	16434177	missense	probably damaging	1.00
R5708:Rarb	UTSW	14	16548545	missense	probably damaging	0.99
R5819:Rarb	UTSW	14	16443820	missense	possibly damaging	0.68
R5935:Rarb	UTSW	14	16434264	missense	probably damaging	1.00
R6264:Rarb	UTSW	14	16818819	missense	probably benign	0.31
R6823:Rarb	UTSW	14	16443824	missense	probably damaging	1.00
R6975:Rarb	UTSW	14	16574942	missense	possibly damaging	0.92
R7295:Rarb	UTSW	14	16508932	critical splice donor site	probably null
R7402:Rarb	UTSW	14	16548419	missense	probably damaging	1.00
R7849:Rarb	UTSW	14	16548473	missense	probably damaging	1.00
R7932:Rarb	UTSW	14	16548473	missense	probably damaging	1.00
X0065:Rarb	UTSW	14	16434303	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGAGTTGCTCTTCTACCCAGCCATC -3'
(R):5'- TACAGGCTGCCCAGGGTTCTTTTG -3'

Sequencing Primer
(F):5'- GTGCTCAGACAAGGCTAATTC -3'
(R):5'- CTTACTAAGGGGGCATCTTCAAG -3'

Posted On

2013-10-16