Incidental Mutation 'R0849:Rarb'
ID77089
Institutional Source Beutler Lab
Gene Symbol Rarb
Ensembl Gene ENSMUSG00000017491
Gene Nameretinoic acid receptor, beta
SynonymsRAR beta 2, Hap, RARbeta2
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16430839-16819156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16434293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 295 (V295A)
Ref Sequence ENSEMBL: ENSMUSP00000152980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000225921]
Predicted Effect probably benign
Transcript: ENSMUST00000017629
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063750
AA Change: V341A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491
AA Change: V341A

DomainStartEndE-ValueType
low complexity region 52 75 N/A INTRINSIC
ZnF_C4 78 149 3.77e-40 SMART
HOLI 223 381 1.72e-34 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223576
Predicted Effect probably damaging
Transcript: ENSMUST00000225921
AA Change: V295A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Rarb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Rarb APN 14 16443791 nonsense probably null
IGL01483:Rarb APN 14 16432273 splice site probably benign
IGL01591:Rarb APN 14 16434207 missense possibly damaging 0.93
IGL01769:Rarb APN 14 16443760 missense probably damaging 0.97
IGL01782:Rarb APN 14 16434180 missense probably damaging 1.00
IGL01866:Rarb APN 14 16443751 missense probably benign 0.17
IGL03299:Rarb APN 14 16434168 missense probably damaging 1.00
IGL03134:Rarb UTSW 14 16436910 missense probably damaging 0.99
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R1067:Rarb UTSW 14 16436769 missense probably damaging 0.98
R1314:Rarb UTSW 14 16508932 critical splice donor site probably null
R1416:Rarb UTSW 14 16435177 missense possibly damaging 0.82
R2894:Rarb UTSW 14 16435146 missense probably damaging 1.00
R4637:Rarb UTSW 14 16574875 missense possibly damaging 0.51
R4950:Rarb UTSW 14 16432085 unclassified probably benign
R5420:Rarb UTSW 14 16434249 missense possibly damaging 0.89
R5456:Rarb UTSW 14 16436843 missense probably damaging 1.00
R5635:Rarb UTSW 14 16443788 missense probably damaging 1.00
R5689:Rarb UTSW 14 16434177 missense probably damaging 1.00
R5708:Rarb UTSW 14 16548545 missense probably damaging 0.99
R5819:Rarb UTSW 14 16443820 missense possibly damaging 0.68
R5935:Rarb UTSW 14 16434264 missense probably damaging 1.00
R6264:Rarb UTSW 14 16818819 missense probably benign 0.31
R6823:Rarb UTSW 14 16443824 missense probably damaging 1.00
R6975:Rarb UTSW 14 16574942 missense possibly damaging 0.92
R7295:Rarb UTSW 14 16508932 critical splice donor site probably null
R7402:Rarb UTSW 14 16548419 missense probably damaging 1.00
R7849:Rarb UTSW 14 16548473 missense probably damaging 1.00
R7932:Rarb UTSW 14 16548473 missense probably damaging 1.00
X0065:Rarb UTSW 14 16434303 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAGTTGCTCTTCTACCCAGCCATC -3'
(R):5'- TACAGGCTGCCCAGGGTTCTTTTG -3'

Sequencing Primer
(F):5'- GTGCTCAGACAAGGCTAATTC -3'
(R):5'- CTTACTAAGGGGGCATCTTCAAG -3'
Posted On2013-10-16