Incidental Mutation 'R0840:Fblim1'
ID77101
Institutional Source Beutler Lab
Gene Symbol Fblim1
Ensembl Gene ENSMUSG00000006219
Gene Namefilamin binding LIM protein 1
Synonyms
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141576062-141606096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141581009 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 330 (F330L)
Ref Sequence ENSEMBL: ENSMUSP00000101411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006381] [ENSMUST00000105784] [ENSMUST00000105785]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006381
AA Change: F330L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006381
Gene: ENSMUSG00000006219
AA Change: F330L

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105784
AA Change: F330L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101410
Gene: ENSMUSG00000006219
AA Change: F330L

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105785
AA Change: F330L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101411
Gene: ENSMUSG00000006219
AA Change: F330L

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Meta Mutation Damage Score 0.7326 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit severe osteopenia with decreased osteoblasts and increased osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Fblim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02634:Fblim1 APN 4 141583111 missense probably benign 0.43
IGL03036:Fblim1 APN 4 141583124 missense possibly damaging 0.65
IGL02802:Fblim1 UTSW 4 141590120 missense possibly damaging 0.90
PIT4377001:Fblim1 UTSW 4 141595409 missense probably damaging 1.00
R1793:Fblim1 UTSW 4 141595238 missense probably damaging 1.00
R1975:Fblim1 UTSW 4 141584864 missense probably damaging 1.00
R4829:Fblim1 UTSW 4 141584709 missense probably damaging 1.00
R6066:Fblim1 UTSW 4 141577909 missense probably damaging 1.00
R6101:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6126:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6127:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6128:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R7525:Fblim1 UTSW 4 141590080 missense probably damaging 1.00
Z1176:Fblim1 UTSW 4 141595371 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGCTAACGATGCTGTCACCACCC -3'
(R):5'- TGCAGCTTCACACCTTTGACCAG -3'

Sequencing Primer
(F):5'- ttccaacttcctctgcttcc -3'
(R):5'- AGCTGATTCCTTGGTCAGTG -3'
Posted On2013-10-16