Incidental Mutation 'R0840:Pisd'
ID77102
Institutional Source Beutler Lab
Gene Symbol Pisd
Ensembl Gene ENSMUSG00000023452
Gene Namephosphatidylserine decarboxylase
Synonyms
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32736301-32785646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32737312 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 380 (I380T)
Ref Sequence ENSEMBL: ENSMUSP00000051438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061895] [ENSMUST00000071829] [ENSMUST00000120591] [ENSMUST00000135248] [ENSMUST00000142957] [ENSMUST00000144673] [ENSMUST00000197787] [ENSMUST00000200390] [ENSMUST00000202283]
Predicted Effect probably damaging
Transcript: ENSMUST00000061895
AA Change: I380T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051438
Gene: ENSMUSG00000023452
AA Change: I380T

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 162 405 1.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071829
SMART Domains Protein: ENSMUSP00000071732
Gene: ENSMUSG00000023452

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 260 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119864
Predicted Effect probably damaging
Transcript: ENSMUST00000120591
AA Change: I349T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112573
Gene: ENSMUSG00000023452
AA Change: I349T

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 374 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138360
Predicted Effect unknown
Transcript: ENSMUST00000142779
AA Change: I332T
SMART Domains Protein: ENSMUSP00000122705
Gene: ENSMUSG00000023452
AA Change: I332T

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 153 270 1.7e-33 PFAM
Pfam:PS_Dcarbxylase 268 358 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142957
Predicted Effect probably damaging
Transcript: ENSMUST00000144673
AA Change: I550T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574
AA Change: I550T

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196545
Predicted Effect probably benign
Transcript: ENSMUST00000197787
Predicted Effect probably benign
Transcript: ENSMUST00000200390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201980
Predicted Effect probably benign
Transcript: ENSMUST00000202283
Meta Mutation Damage Score 0.6197 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylserine to phosphatidylethanolamine in the inner mitochondrial membrane. The encoded protein is active in phospholipid metabolism and interorganelle trafficking of phosphatidylserine. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryogenesis defects such as abnormal trophoblast development, abnormal extraembronic tissue morphology and abnormal mitochondrial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Pisd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pisd APN 5 32738412 missense probably benign 0.02
IGL00540:Pisd APN 5 32738412 missense probably benign 0.02
IGL00577:Pisd APN 5 32738412 missense probably benign 0.02
IGL00580:Pisd APN 5 32738412 missense probably benign 0.02
IGL00590:Pisd APN 5 32738412 missense probably benign 0.02
IGL00990:Pisd APN 5 32739358 missense probably benign 0.24
IGL01899:Pisd APN 5 32739132 splice site probably null
IGL01908:Pisd APN 5 32739132 splice site probably null
IGL01928:Pisd APN 5 32739132 splice site probably null
IGL01931:Pisd APN 5 32739132 splice site probably null
IGL01935:Pisd APN 5 32739132 splice site probably null
IGL01948:Pisd APN 5 32739132 splice site probably null
IGL01952:Pisd APN 5 32739132 splice site probably null
IGL02195:Pisd APN 5 32737315 missense probably damaging 1.00
shandong UTSW 5 32764796 missense possibly damaging 0.94
R0674:Pisd UTSW 5 32774437 missense probably benign 0.00
R1976:Pisd UTSW 5 32738865 missense probably damaging 1.00
R1986:Pisd UTSW 5 32737328 missense probably damaging 1.00
R2044:Pisd UTSW 5 32764796 missense possibly damaging 0.94
R5705:Pisd UTSW 5 32737363 missense probably benign 0.14
R5756:Pisd UTSW 5 32738498 missense probably damaging 1.00
R6249:Pisd UTSW 5 32738844 missense probably damaging 1.00
R6389:Pisd UTSW 5 32764847 missense probably damaging 1.00
R6913:Pisd UTSW 5 32737429 missense probably damaging 1.00
R7143:Pisd UTSW 5 32738502 missense possibly damaging 0.73
R7571:Pisd UTSW 5 32737337 missense probably damaging 1.00
R7626:Pisd UTSW 5 32740688 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTGGGGTCAAATCACACCCACC -3'
(R):5'- GCGCTAACCTTTCAGCATTTATGTCTG -3'

Sequencing Primer
(F):5'- TCTAGGTCCTGTCCTGAGAGAC -3'
(R):5'- GCCTTGTCAAAGTCACAGC -3'
Posted On2013-10-16