Mutagenetix > Incidental Mutations

Incidental Mutation 'R0840:A930011G23Rik'

List |< first << previous [record 3 of 51] next >> last >|

77103

Institutional Source

Beutler Lab

Gene Symbol

A930011G23Rik

Ensembl Gene

ENSMUSG00000089809

Gene Name

RIKEN cDNA A930011G23 gene

Synonyms

MMRRC Submission

039019-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R0840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99297244-99729065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99234688 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 234 (T234A)

Ref Sequence

ENSEMBL: ENSMUSP00000147997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031276] [ENSMUST00000166484] [ENSMUST00000168092] [ENSMUST00000209346]

Predicted Effect

probably benign
Transcript: ENSMUST00000031276
AA Change: T148A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031276
Gene: ENSMUSG00000089809
AA Change: T148A

Domain	Start	End	E-Value	Type
RasGEFN	33	157	5.22e-4	SMART
RasGEF	201	454	3.26e-68	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166484
AA Change: T106A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128947
Gene: ENSMUSG00000089809
AA Change: T106A

Domain	Start	End	E-Value	Type
Blast:RasGEFN	33	123	6e-50	BLAST
RasGEF	159	412	3.26e-68	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166632

Predicted Effect

probably benign
Transcript: ENSMUST00000168092
AA Change: T147A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129652
Gene: ENSMUSG00000089809
AA Change: T147A

Domain	Start	End	E-Value	Type
RasGEFN	33	157	2.8e-4	SMART
RasGEF	200	453	3.26e-68	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000209346
AA Change: T234A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0588

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810020O05Rik	G	T	6: 87,680,278		noncoding transcript	Het
2700049A03Rik	C	G	12: 71,158,883	Q434E	probably benign	Het
Acot5	G	A	12: 84,075,840	W399*	probably null	Het
Adra1a	A	G	14: 66,727,710	E383G	possibly damaging	Het
Ahnak	T	A	19: 9,005,063	I1237N	probably damaging	Het
Bsg	A	G	10: 79,709,685	T28A	probably damaging	Het
Cacna1i	A	T	15: 80,358,949	I436F	possibly damaging	Het
Cd109	T	C	9: 78,664,330	I417T	probably benign	Het
Cep295	A	T	9: 15,334,315	D948E	probably benign	Het
Clcn3	C	A	8: 60,929,154	V467F	probably benign	Het
Cntnap3	T	C	13: 64,787,910	S380G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dll4	T	A	2: 119,326,485	N79K	probably benign	Het
Ep300	A	T	15: 81,644,933	N1558I	unknown	Het
Fblim1	A	G	4: 141,581,009	F330L	possibly damaging	Het
Fbxo46	T	A	7: 19,137,148	M564K	possibly damaging	Het
Fnip1	T	A	11: 54,493,181		probably benign	Het
Foxl2	A	T	9: 98,955,931	K91*	probably null	Het
Gapvd1	C	A	2: 34,729,113	V83F	probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
Irf8	G	A	8: 120,753,481	G153S	probably benign	Het
Kcnu1	T	A	8: 25,913,684	M1K	probably null	Het
Krt32	G	A	11: 100,081,242	P427S	probably benign	Het
Lrp12	A	G	15: 39,876,158	S529P	probably damaging	Het
Mettl22	T	C	16: 8,482,157	V134A	probably damaging	Het
Morc2b	G	T	17: 33,136,112	H895Q	probably benign	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Nrxn3	A	G	12: 90,331,793	S1367G	possibly damaging	Het
Olfr129	A	G	17: 38,055,572	F7S	probably benign	Het
Olfr504	A	T	7: 108,565,616	S60T	probably benign	Het
Pcnx3	T	A	19: 5,685,701		probably null	Het
Pgap2	A	T	7: 102,237,448	M226L	probably damaging	Het
Pik3c2g	A	G	6: 139,896,072	I616M	probably damaging	Het
Pisd	A	G	5: 32,737,312	I380T	probably damaging	Het
Pkhd1	T	C	1: 20,350,521	I2454V	probably damaging	Het
Plpp2	A	G	10: 79,527,544	I151T	probably benign	Het
Polr3a	G	A	14: 24,452,200	T1295I	possibly damaging	Het
Pot1a	T	C	6: 25,748,284		probably benign	Het
Prpf39	T	G	12: 65,048,206	N219K	probably benign	Het
Rnf17	T	A	14: 56,475,447	N790K	probably damaging	Het
Slit3	C	T	11: 35,623,436		probably benign	Het
Stx1a	T	A	5: 135,041,234		probably benign	Het
Tenm3	C	A	8: 48,335,742	V690F	probably damaging	Het
Tmcc3	A	G	10: 94,578,771	I143V	probably benign	Het
Tmem41b	G	A	7: 109,981,049	S36F	probably damaging	Het
Trim5	A	T	7: 104,265,771	W364R	probably damaging	Het
Ttn	T	C	2: 76,786,811	Y16403C	probably damaging	Het
Vps8	T	C	16: 21,456,321	S210P	probably damaging	Het
Zbtb3	T	A	19: 8,803,457	S145T	possibly damaging	Het
Zfp882	T	A	8: 71,914,686	C452*	probably null	Het

Other mutations in A930011G23Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:A930011G23Rik	APN	5	99243243	splice site	probably null
IGL00536:A930011G23Rik	APN	5	99222383	missense	probably damaging	1.00
IGL00848:A930011G23Rik	APN	5	99222378	missense	probably damaging	1.00
IGL01400:A930011G23Rik	APN	5	99243101	missense	probably damaging	1.00
IGL02421:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02421:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02422:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02422:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02423:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02423:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02424:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02424:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02427:A930011G23Rik	APN	5	99233970	missense	probably damaging	1.00
IGL02437:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02437:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02473:A930011G23Rik	APN	5	99222995	missense	probably damaging	1.00
IGL02498:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02498:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02499:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02499:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02537:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02537:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02609:A930011G23Rik	APN	5	99233995	splice site	probably benign
IGL02735:A930011G23Rik	APN	5	99229377	missense	probably damaging	1.00
IGL02735:A930011G23Rik	APN	5	99229382	missense	probably damaging	1.00
IGL02975:A930011G23Rik	APN	5	99233925	missense	possibly damaging	0.81
IGL03129:A930011G23Rik	APN	5	99229379	missense	probably damaging	0.98
IGL03139:A930011G23Rik	APN	5	99243208	missense	probably benign	0.00
IGL03239:A930011G23Rik	APN	5	99233976	missense	probably damaging	1.00
IGL03295:A930011G23Rik	APN	5	99243056	splice site	probably benign
R0011:A930011G23Rik	UTSW	5	99232354	missense	probably damaging	1.00
R0738:A930011G23Rik	UTSW	5	99240953	missense	probably benign	0.08
R1779:A930011G23Rik	UTSW	5	99223038	splice site	probably benign
R1799:A930011G23Rik	UTSW	5	99234576	missense	probably benign	0.01
R1992:A930011G23Rik	UTSW	5	99233925	missense	possibly damaging	0.81
R2054:A930011G23Rik	UTSW	5	99228055	missense	probably benign	0.01
R2157:A930011G23Rik	UTSW	5	99232097	missense	probably damaging	0.99
R2184:A930011G23Rik	UTSW	5	99232369	missense	possibly damaging	0.69
R4565:A930011G23Rik	UTSW	5	99227947	intron	probably benign
R4930:A930011G23Rik	UTSW	5	99222404	missense	possibly damaging	0.81
R5065:A930011G23Rik	UTSW	5	99234573	missense	probably benign	0.18
R5739:A930011G23Rik	UTSW	5	99221430	missense	probably damaging	1.00
R5806:A930011G23Rik	UTSW	5	99240872	missense	probably benign	0.05
R8228:A930011G23Rik	UTSW	5	99377121	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CATGATGTCCCGCTGTATGGACTG -3'
(R):5'- TATAGGCATGGAGAAGCCCCGTAG -3'

Sequencing Primer
(F):5'- GGGGCTTGGTCTTCAGAACC -3'
(R):5'- CAGTTTCACTAGAGCACGCTTAG -3'

Posted On

2013-10-16