Incidental Mutation 'R0840:Stx1a'
ID77104
Institutional Source Beutler Lab
Gene Symbol Stx1a
Ensembl Gene ENSMUSG00000007207
Gene Namesyntaxin 1A (brain)
SynonymsHPC-1
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0840 (G1)
Quality Score200
Status Validated
Chromosome5
Chromosomal Location135023482-135051100 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 135041234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005509] [ENSMUST00000150838] [ENSMUST00000201008]
Predicted Effect probably benign
Transcript: ENSMUST00000005509
SMART Domains Protein: ENSMUSP00000005509
Gene: ENSMUSG00000007207

DomainStartEndE-ValueType
SynN 25 146 4.44e-42 SMART
t_SNARE 187 254 3.28e-24 SMART
transmembrane domain 266 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144198
Predicted Effect probably benign
Transcript: ENSMUST00000150838
SMART Domains Protein: ENSMUSP00000117144
Gene: ENSMUSG00000007207

DomainStartEndE-ValueType
SynN 25 146 4.44e-42 SMART
Pfam:SNARE 197 231 6.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156626
Predicted Effect probably benign
Transcript: ENSMUST00000201008
SMART Domains Protein: ENSMUSP00000144082
Gene: ENSMUSG00000007207

DomainStartEndE-ValueType
SynN 25 121 1.3e-23 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor] domain (known as H3), and an N-terminal regulatory domain (Habc). Syntaxins bind synaptotagmin in a calcium-dependent fashion and interact with voltage dependent calcium and potassium channels via the C-terminal H3 domain. This gene product is a key molecule in ion channel regulation and synaptic exocytosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mice for one targeted mutation display impairments in LTP, cued fear memory consolidation and cued fear memory extinction while mice with another targeted mutation show no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Stx1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Stx1a APN 5 135045664 missense probably damaging 0.99
IGL01956:Stx1a APN 5 135037469 splice site probably benign
IGL02448:Stx1a APN 5 135023619 splice site probably benign
R0140:Stx1a UTSW 5 135045585 splice site probably benign
R5810:Stx1a UTSW 5 135049078 missense probably damaging 0.99
R7345:Stx1a UTSW 5 135037188 missense probably benign 0.00
R7536:Stx1a UTSW 5 135049840 missense probably damaging 1.00
R8085:Stx1a UTSW 5 135037577 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCACCCGTTAAGTAAACAGTCCTC -3'
(R):5'- AACCCAGGCTGTCCTCAAGCTATG -3'

Sequencing Primer
(F):5'- CCCATCTGTTATCTACAGGGGAAG -3'
(R):5'- gctgtcctgatccttatacctcc -3'
Posted On2013-10-16