Mutagenetix > Incidental Mutations

Incidental Mutation 'R0840:Pot1a'

77105

Institutional Source

Beutler Lab

Gene Symbol

Pot1a

Ensembl Gene

ENSMUSG00000029676

Gene Name

protection of telomeres 1A

Synonyms

1500031H18Rik, Pot1

MMRRC Submission

039019-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25743737-25809246 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 25748284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115330] [ENSMUST00000166445]

AlphaFold

Q91WC1

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115329

SMART Domains

Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115330

SMART Domains

Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
Pfam:POT1PC	152	299	6.7e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134339

Predicted Effect

probably benign
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810020O05Rik	G	T	6: 87,680,278		noncoding transcript	Het
2700049A03Rik	C	G	12: 71,158,883	Q434E	probably benign	Het
A930011G23Rik	T	C	5: 99,234,688	T234A	probably benign	Het
Acot5	G	A	12: 84,075,840	W399*	probably null	Het
Adra1a	A	G	14: 66,727,710	E383G	possibly damaging	Het
Ahnak	T	A	19: 9,005,063	I1237N	probably damaging	Het
Bsg	A	G	10: 79,709,685	T28A	probably damaging	Het
Cacna1i	A	T	15: 80,358,949	I436F	possibly damaging	Het
Cd109	T	C	9: 78,664,330	I417T	probably benign	Het
Cep295	A	T	9: 15,334,315	D948E	probably benign	Het
Clcn3	C	A	8: 60,929,154	V467F	probably benign	Het
Cntnap3	T	C	13: 64,787,910	S380G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dll4	T	A	2: 119,326,485	N79K	probably benign	Het
Ep300	A	T	15: 81,644,933	N1558I	unknown	Het
Fblim1	A	G	4: 141,581,009	F330L	possibly damaging	Het
Fbxo46	T	A	7: 19,137,148	M564K	possibly damaging	Het
Fnip1	T	A	11: 54,493,181		probably benign	Het
Foxl2	A	T	9: 98,955,931	K91*	probably null	Het
Gapvd1	C	A	2: 34,729,113	V83F	probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
Irf8	G	A	8: 120,753,481	G153S	probably benign	Het
Kcnu1	T	A	8: 25,913,684	M1K	probably null	Het
Krt32	G	A	11: 100,081,242	P427S	probably benign	Het
Lrp12	A	G	15: 39,876,158	S529P	probably damaging	Het
Mettl22	T	C	16: 8,482,157	V134A	probably damaging	Het
Morc2b	G	T	17: 33,136,112	H895Q	probably benign	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Nrxn3	A	G	12: 90,331,793	S1367G	possibly damaging	Het
Olfr129	A	G	17: 38,055,572	F7S	probably benign	Het
Olfr504	A	T	7: 108,565,616	S60T	probably benign	Het
Pcnx3	T	A	19: 5,685,701		probably null	Het
Pgap2	A	T	7: 102,237,448	M226L	probably damaging	Het
Pik3c2g	A	G	6: 139,896,072	I616M	probably damaging	Het
Pisd	A	G	5: 32,737,312	I380T	probably damaging	Het
Pkhd1	T	C	1: 20,350,521	I2454V	probably damaging	Het
Plpp2	A	G	10: 79,527,544	I151T	probably benign	Het
Polr3a	G	A	14: 24,452,200	T1295I	possibly damaging	Het
Prpf39	T	G	12: 65,048,206	N219K	probably benign	Het
Rnf17	T	A	14: 56,475,447	N790K	probably damaging	Het
Slit3	C	T	11: 35,623,436		probably benign	Het
Stx1a	T	A	5: 135,041,234		probably benign	Het
Tenm3	C	A	8: 48,335,742	V690F	probably damaging	Het
Tmcc3	A	G	10: 94,578,771	I143V	probably benign	Het
Tmem41b	G	A	7: 109,981,049	S36F	probably damaging	Het
Trim5	A	T	7: 104,265,771	W364R	probably damaging	Het
Ttn	T	C	2: 76,786,811	Y16403C	probably damaging	Het
Vps8	T	C	16: 21,456,321	S210P	probably damaging	Het
Zbtb3	T	A	19: 8,803,457	S145T	possibly damaging	Het
Zfp882	T	A	8: 71,914,686	C452*	probably null	Het

Other mutations in Pot1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00857:Pot1a	APN	6	25744628	missense	probably benign	0.01
IGL01393:Pot1a	APN	6	25744631	nonsense	probably null
IGL01411:Pot1a	APN	6	25750144	splice site	probably benign
IGL01774:Pot1a	APN	6	25753277	missense	probably benign	0.00
IGL01981:Pot1a	APN	6	25750100	missense	probably damaging	1.00
IGL02404:Pot1a	APN	6	25764432	splice site	probably benign
IGL02530:Pot1a	APN	6	25794593	missense	probably damaging	1.00
IGL02755:Pot1a	APN	6	25771613	missense	possibly damaging	0.81
IGL03127:Pot1a	APN	6	25794616	missense	probably benign	0.00
IGL03396:Pot1a	APN	6	25745914	missense	possibly damaging	0.93
BB001:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
BB011:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
R0329:Pot1a	UTSW	6	25778831	splice site	probably benign
R0359:Pot1a	UTSW	6	25771680	splice site	probably benign
R0530:Pot1a	UTSW	6	25771541	missense	possibly damaging	0.86
R0918:Pot1a	UTSW	6	25756268	missense	possibly damaging	0.92
R1650:Pot1a	UTSW	6	25745965	missense	probably damaging	1.00
R1937:Pot1a	UTSW	6	25753324	missense	probably benign	0.15
R2142:Pot1a	UTSW	6	25750044	splice site	probably null
R4072:Pot1a	UTSW	6	25752357	splice site	probably null
R4074:Pot1a	UTSW	6	25752357	splice site	probably null
R4322:Pot1a	UTSW	6	25745930	missense	probably benign	0.02
R4895:Pot1a	UTSW	6	25753206	missense	probably damaging	1.00
R4910:Pot1a	UTSW	6	25746021	intron	probably benign
R4933:Pot1a	UTSW	6	25771541	missense	possibly damaging	0.86
R5530:Pot1a	UTSW	6	25778894	missense	probably damaging	1.00
R5748:Pot1a	UTSW	6	25758856	missense	possibly damaging	0.77
R5775:Pot1a	UTSW	6	25757298	splice site	probably null
R5870:Pot1a	UTSW	6	25778951	missense	possibly damaging	0.90
R6180:Pot1a	UTSW	6	25771621	missense	probably benign	0.00
R6377:Pot1a	UTSW	6	25778870	missense	probably benign	0.06
R7251:Pot1a	UTSW	6	25752498	splice site	probably null
R7457:Pot1a	UTSW	6	25771622	missense	probably benign	0.26
R7679:Pot1a	UTSW	6	25771634	missense	probably benign	0.16
R7717:Pot1a	UTSW	6	25758823	missense	probably benign	0.45
R7924:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
R8078:Pot1a	UTSW	6	25750108	missense	probably benign	0.13
R8084:Pot1a	UTSW	6	25771536	missense	possibly damaging	0.81
R8170:Pot1a	UTSW	6	25758803	makesense	probably null
R9070:Pot1a	UTSW	6	25744630	missense

Predicted Primers

PCR Primer
(F):5'- ACAGGGAGAATGTCGCCTCAAAC -3'
(R):5'- TCAGCTTATAAAACGTCCCGTTGCC -3'

Sequencing Primer
(F):5'- aaatCAAAGGCAAAGACATAATATCG -3'
(R):5'- CCGTTGCCAGACGTAATGTG -3'

Posted On

2013-10-16