Mutagenetix > Incidental Mutations

Incidental Mutation 'R0840:Pik3c2g'

77107

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

039019-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R0840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139896072 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 616 (I616M)

Ref Sequence

ENSEMBL: ENSMUSP00000151281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087657
AA Change: I366M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: I366M

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111868
AA Change: I734M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: I734M

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189374

SMART Domains

Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206646
AA Change: I366M

Predicted Effect

probably damaging
Transcript: ENSMUST00000218528
AA Change: I616M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2090

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810020O05Rik	G	T	6: 87,680,278		noncoding transcript	Het
2700049A03Rik	C	G	12: 71,158,883	Q434E	probably benign	Het
A930011G23Rik	T	C	5: 99,234,688	T234A	probably benign	Het
Acot5	G	A	12: 84,075,840	W399*	probably null	Het
Adra1a	A	G	14: 66,727,710	E383G	possibly damaging	Het
Ahnak	T	A	19: 9,005,063	I1237N	probably damaging	Het
Bsg	A	G	10: 79,709,685	T28A	probably damaging	Het
Cacna1i	A	T	15: 80,358,949	I436F	possibly damaging	Het
Cd109	T	C	9: 78,664,330	I417T	probably benign	Het
Cep295	A	T	9: 15,334,315	D948E	probably benign	Het
Clcn3	C	A	8: 60,929,154	V467F	probably benign	Het
Cntnap3	T	C	13: 64,787,910	S380G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dll4	T	A	2: 119,326,485	N79K	probably benign	Het
Ep300	A	T	15: 81,644,933	N1558I	unknown	Het
Fblim1	A	G	4: 141,581,009	F330L	possibly damaging	Het
Fbxo46	T	A	7: 19,137,148	M564K	possibly damaging	Het
Fnip1	T	A	11: 54,493,181		probably benign	Het
Foxl2	A	T	9: 98,955,931	K91*	probably null	Het
Gapvd1	C	A	2: 34,729,113	V83F	probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
Irf8	G	A	8: 120,753,481	G153S	probably benign	Het
Kcnu1	T	A	8: 25,913,684	M1K	probably null	Het
Krt32	G	A	11: 100,081,242	P427S	probably benign	Het
Lrp12	A	G	15: 39,876,158	S529P	probably damaging	Het
Mettl22	T	C	16: 8,482,157	V134A	probably damaging	Het
Morc2b	G	T	17: 33,136,112	H895Q	probably benign	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Nrxn3	A	G	12: 90,331,793	S1367G	possibly damaging	Het
Olfr129	A	G	17: 38,055,572	F7S	probably benign	Het
Olfr504	A	T	7: 108,565,616	S60T	probably benign	Het
Pcnx3	T	A	19: 5,685,701		probably null	Het
Pgap2	A	T	7: 102,237,448	M226L	probably damaging	Het
Pisd	A	G	5: 32,737,312	I380T	probably damaging	Het
Pkhd1	T	C	1: 20,350,521	I2454V	probably damaging	Het
Plpp2	A	G	10: 79,527,544	I151T	probably benign	Het
Polr3a	G	A	14: 24,452,200	T1295I	possibly damaging	Het
Pot1a	T	C	6: 25,748,284		probably benign	Het
Prpf39	T	G	12: 65,048,206	N219K	probably benign	Het
Rnf17	T	A	14: 56,475,447	N790K	probably damaging	Het
Slit3	C	T	11: 35,623,436		probably benign	Het
Stx1a	T	A	5: 135,041,234		probably benign	Het
Tenm3	C	A	8: 48,335,742	V690F	probably damaging	Het
Tmcc3	A	G	10: 94,578,771	I143V	probably benign	Het
Tmem41b	G	A	7: 109,981,049	S36F	probably damaging	Het
Trim5	A	T	7: 104,265,771	W364R	probably damaging	Het
Ttn	T	C	2: 76,786,811	Y16403C	probably damaging	Het
Vps8	T	C	16: 21,456,321	S210P	probably damaging	Het
Zbtb3	T	A	19: 8,803,457	S145T	possibly damaging	Het
Zfp882	T	A	8: 71,914,686	C452*	probably null	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACACTGTCTGCCCAGTCTTTCC -3'
(R):5'- GCTGTGTGTCTTGCTGAACCCT -3'

Sequencing Primer
(F):5'- tctcctctctctttttctctttctc -3'
(R):5'- GCTGAACCCTAAAATTGTGACTCTC -3'

Posted On

2013-10-16