Incidental Mutation 'R0840:Pgap2'
ID77110
Institutional Source Beutler Lab
Gene Symbol Pgap2
Ensembl Gene ENSMUSG00000030990
Gene Namepost-GPI attachment to proteins 2
Synonyms1810006G21Rik, Frag1
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102210208-102238567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102237448 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 226 (M226L)
Ref Sequence ENSEMBL: ENSMUSP00000113574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033292] [ENSMUST00000098230] [ENSMUST00000106923] [ENSMUST00000119816] [ENSMUST00000120119] [ENSMUST00000120879] [ENSMUST00000126914] [ENSMUST00000129340] [ENSMUST00000138479] [ENSMUST00000156529] [ENSMUST00000209968] [ENSMUST00000142873] [ENSMUST00000138753] [ENSMUST00000143541] [ENSMUST00000153020] [ENSMUST00000140058] [ENSMUST00000145352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033292
AA Change: M228L

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033292
Gene: ENSMUSG00000030990
AA Change: M228L

DomainStartEndE-ValueType
Pfam:Frag1 18 241 2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098230
SMART Domains Protein: ENSMUSP00000095832
Gene: ENSMUSG00000073982

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106923
SMART Domains Protein: ENSMUSP00000102536
Gene: ENSMUSG00000073982

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119816
SMART Domains Protein: ENSMUSP00000113261
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120119
AA Change: M226L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113574
Gene: ENSMUSG00000030990
AA Change: M226L

DomainStartEndE-ValueType
Pfam:Frag1 16 239 1.6e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120879
AA Change: M224L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114016
Gene: ENSMUSG00000030990
AA Change: M224L

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126914
SMART Domains Protein: ENSMUSP00000114853
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 101 6.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127804
Predicted Effect probably benign
Transcript: ENSMUST00000129340
SMART Domains Protein: ENSMUSP00000119692
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134621
Predicted Effect probably benign
Transcript: ENSMUST00000138479
SMART Domains Protein: ENSMUSP00000115590
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156529
AA Change: M224L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121521
Gene: ENSMUSG00000030990
AA Change: M224L

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143759
Predicted Effect probably benign
Transcript: ENSMUST00000209968
Predicted Effect probably benign
Transcript: ENSMUST00000142873
SMART Domains Protein: ENSMUSP00000121988
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 136 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138753
SMART Domains Protein: ENSMUSP00000116858
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 123 9.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143541
SMART Domains Protein: ENSMUSP00000117450
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 79 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153020
SMART Domains Protein: ENSMUSP00000123570
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140058
SMART Domains Protein: ENSMUSP00000122482
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145352
SMART Domains Protein: ENSMUSP00000123523
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214560
Meta Mutation Damage Score 0.3595 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Pgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Pgap2 APN 7 102226454 splice site probably benign
IGL01363:Pgap2 APN 7 102226282 start codon destroyed probably null 1.00
IGL02352:Pgap2 APN 7 102236139 missense probably damaging 1.00
IGL02359:Pgap2 APN 7 102236139 missense probably damaging 1.00
IGL02638:Pgap2 APN 7 102237422 missense probably damaging 1.00
IGL03097:Pgap2 UTSW 7 102236227 missense probably damaging 1.00
PIT4131001:Pgap2 UTSW 7 102237198 missense possibly damaging 0.45
R0452:Pgap2 UTSW 7 102236462 missense probably damaging 1.00
R0747:Pgap2 UTSW 7 102237136 nonsense probably null
R4551:Pgap2 UTSW 7 102226467 intron probably benign
R5122:Pgap2 UTSW 7 102231391 missense probably damaging 1.00
R6440:Pgap2 UTSW 7 102237387 splice site probably null
R7358:Pgap2 UTSW 7 102210567 unclassified probably benign
R7363:Pgap2 UTSW 7 102226260 splice site probably null
R7405:Pgap2 UTSW 7 102231388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTCTAAGATGGAAGCCCACCAAC -3'
(R):5'- AGGACCTTTCAGTGAATGGTGATGC -3'

Sequencing Primer
(F):5'- CTTTAGGATCGCAAGTCCTACAG -3'
(R):5'- TCTTGAAGATCCCCATGAGTG -3'
Posted On2013-10-16