Incidental Mutation 'R0840:Trim5'
ID77111
Institutional Source Beutler Lab
Gene Symbol Trim5
Ensembl Gene ENSMUSG00000060441
Gene Nametripartite motif-containing 5
Synonyms
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104263386-104288094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104265771 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 364 (W364R)
Ref Sequence ENSEMBL: ENSMUSP00000095781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]
Predicted Effect probably damaging
Transcript: ENSMUST00000051795
AA Change: W364R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441
AA Change: W364R

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060315
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098179
AA Change: W364R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441
AA Change: W364R

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106848
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106849
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217156
Meta Mutation Damage Score 0.9423 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Trim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Trim5 APN 7 104279431 missense probably damaging 1.00
IGL02165:Trim5 APN 7 104279359 missense probably damaging 1.00
IGL02576:Trim5 APN 7 104278417 missense probably damaging 0.97
IGL02660:Trim5 APN 7 104266218 missense probably damaging 0.96
IGL02732:Trim5 APN 7 104278465 missense probably benign 0.02
R0278:Trim5 UTSW 7 104279675 missense probably benign 0.00
R0373:Trim5 UTSW 7 104265684 missense probably benign 0.00
R0508:Trim5 UTSW 7 104265604 missense probably null 0.98
R0947:Trim5 UTSW 7 104265751 missense probably damaging 1.00
R1432:Trim5 UTSW 7 104279519 missense probably benign 0.04
R1432:Trim5 UTSW 7 104279521 missense probably benign
R1770:Trim5 UTSW 7 104276661 missense probably damaging 1.00
R1782:Trim5 UTSW 7 104265816 splice site probably null
R1988:Trim5 UTSW 7 104265621 missense probably damaging 0.99
R2140:Trim5 UTSW 7 104276791 nonsense probably null
R3110:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3112:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3893:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R3948:Trim5 UTSW 7 104266520 nonsense probably null
R4114:Trim5 UTSW 7 104265740 missense probably damaging 0.99
R4249:Trim5 UTSW 7 104276815 missense possibly damaging 0.83
R4352:Trim5 UTSW 7 104276808 missense probably damaging 1.00
R4595:Trim5 UTSW 7 104265432 missense probably damaging 1.00
R5057:Trim5 UTSW 7 104265423 missense probably damaging 1.00
R5583:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R5861:Trim5 UTSW 7 104279519 missense probably benign 0.04
R5861:Trim5 UTSW 7 104279521 missense probably benign
R7027:Trim5 UTSW 7 104265668 missense probably benign 0.00
R7078:Trim5 UTSW 7 104278474 missense possibly damaging 0.85
R7150:Trim5 UTSW 7 104276810 missense probably damaging 0.96
R7657:Trim5 UTSW 7 104276677 missense possibly damaging 0.51
R7660:Trim5 UTSW 7 104279362 missense probably damaging 1.00
R7737:Trim5 UTSW 7 104279564 missense probably damaging 1.00
R7821:Trim5 UTSW 7 104278426 missense probably benign 0.32
R7861:Trim5 UTSW 7 104266468 critical splice donor site probably null
R8167:Trim5 UTSW 7 104278423 missense probably damaging 0.99
R8220:Trim5 UTSW 7 104276826 missense probably damaging 0.96
R8296:Trim5 UTSW 7 104265786 missense probably damaging 1.00
Z1088:Trim5 UTSW 7 104266225 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTTGCCTGTGAAAGGACACTCCTC -3'
(R):5'- TGCACAAAGTTCTCTCCAGTGCC -3'

Sequencing Primer
(F):5'- TGTGAAAGGACACTCCTCAAAAG -3'
(R):5'- CGTCACAGATAAGGATGTTTCCTG -3'
Posted On2013-10-16