Incidental Mutation 'R0840:Tmem41b'
ID77113
Institutional Source Beutler Lab
Gene Symbol Tmem41b
Ensembl Gene ENSMUSG00000047554
Gene Nametransmembrane protein 41B
SynonymsD7Ertd743e, D7Ertd70e, 1500031M19Rik, 1500015G02Rik
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109972187-109986929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109981049 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 36 (S36F)
Ref Sequence ENSEMBL: ENSMUSP00000113215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094097] [ENSMUST00000118429] [ENSMUST00000119929] [ENSMUST00000124821] [ENSMUST00000135565] [ENSMUST00000154831]
Predicted Effect probably damaging
Transcript: ENSMUST00000094097
AA Change: S103F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091641
Gene: ENSMUSG00000047554
AA Change: S103F

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Blast:uDENN 81 113 2e-13 BLAST
Pfam:SNARE_assoc 129 250 2.5e-26 PFAM
transmembrane domain 260 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118429
AA Change: S103F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112574
Gene: ENSMUSG00000047554
AA Change: S103F

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Blast:uDENN 81 113 2e-13 BLAST
Pfam:SNARE_assoc 129 250 1.2e-24 PFAM
transmembrane domain 260 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119929
AA Change: S36F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113215
Gene: ENSMUSG00000047554
AA Change: S36F

DomainStartEndE-ValueType
Blast:uDENN 13 48 4e-14 BLAST
Pfam:SNARE_assoc 62 183 6e-27 PFAM
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124821
SMART Domains Protein: ENSMUSP00000119520
Gene: ENSMUSG00000047554

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125703
Predicted Effect possibly damaging
Transcript: ENSMUST00000135565
AA Change: S103F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121078
Gene: ENSMUSG00000047554
AA Change: S103F

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Blast:uDENN 81 113 7e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151587
Predicted Effect probably benign
Transcript: ENSMUST00000154831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207300
Meta Mutation Damage Score 0.3270 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Tmem41b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Tmem41b APN 7 109978702 splice site probably benign
IGL02174:Tmem41b APN 7 109978796 missense possibly damaging 0.89
IGL02232:Tmem41b APN 7 109978753 missense probably damaging 0.98
IGL02523:Tmem41b APN 7 109982728 missense probably damaging 1.00
R0610:Tmem41b UTSW 7 109981083 missense probably benign 0.02
R0610:Tmem41b UTSW 7 109981085 missense probably damaging 0.99
R4610:Tmem41b UTSW 7 109974734 unclassified probably benign
R5502:Tmem41b UTSW 7 109982763 nonsense probably null
R5650:Tmem41b UTSW 7 109974865 missense probably damaging 1.00
R5769:Tmem41b UTSW 7 109978738 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- actgccccgCATTAACATTTGGAA -3'
(R):5'- ACATCCTCCATCCAGTAGTCACCTC -3'

Sequencing Primer
(F):5'- ccccgCATTAACATTTGGAAAAAAAC -3'
(R):5'- gccagccaagtctacatgatg -3'
Posted On2013-10-16