Mutagenetix > Incidental Mutations

Incidental Mutation 'R0840:Clcn3'

List |< first << previous [record 11 of 51] next >> last >|

77116

Institutional Source

Beutler Lab

Gene Symbol

Clcn3

Ensembl Gene

ENSMUSG00000004319

Gene Name

chloride channel, voltage-sensitive 3

Synonyms

Clc3

MMRRC Submission

039019-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.359) question?

Stock #

R0840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60910389-60983300 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 60929154 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 467 (V467F)

Ref Sequence

ENSEMBL: ENSMUSP00000105931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]

Predicted Effect

probably benign
Transcript: ENSMUST00000004430
AA Change: V494F

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: V494F

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	1.4e-111	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	2.08e-8	SMART
low complexity region	847	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056508
AA Change: V467F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: V467F

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.4e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093490
AA Change: V436F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: V436F

Domain	Start	End	E-Value	Type
transmembrane domain	70	92	N/A	INTRINSIC
Pfam:Voltage_CLC	162	565	1.2e-103	PFAM
CBS	609	659	2.46e-1	SMART
CBS	700	747	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110301
AA Change: V494F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: V494F

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	2.7e-103	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110302
AA Change: V467F

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: V467F

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.3e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	2.08e-8	SMART
low complexity region	820	834	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132234

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810020O05Rik	G	T	6: 87,680,278		noncoding transcript	Het
2700049A03Rik	C	G	12: 71,158,883	Q434E	probably benign	Het
A930011G23Rik	T	C	5: 99,234,688	T234A	probably benign	Het
Acot5	G	A	12: 84,075,840	W399*	probably null	Het
Adra1a	A	G	14: 66,727,710	E383G	possibly damaging	Het
Ahnak	T	A	19: 9,005,063	I1237N	probably damaging	Het
Bsg	A	G	10: 79,709,685	T28A	probably damaging	Het
Cacna1i	A	T	15: 80,358,949	I436F	possibly damaging	Het
Cd109	T	C	9: 78,664,330	I417T	probably benign	Het
Cep295	A	T	9: 15,334,315	D948E	probably benign	Het
Cntnap3	T	C	13: 64,787,910	S380G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dll4	T	A	2: 119,326,485	N79K	probably benign	Het
Ep300	A	T	15: 81,644,933	N1558I	unknown	Het
Fblim1	A	G	4: 141,581,009	F330L	possibly damaging	Het
Fbxo46	T	A	7: 19,137,148	M564K	possibly damaging	Het
Fnip1	T	A	11: 54,493,181		probably benign	Het
Foxl2	A	T	9: 98,955,931	K91*	probably null	Het
Gapvd1	C	A	2: 34,729,113	V83F	probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
Irf8	G	A	8: 120,753,481	G153S	probably benign	Het
Kcnu1	T	A	8: 25,913,684	M1K	probably null	Het
Krt32	G	A	11: 100,081,242	P427S	probably benign	Het
Lrp12	A	G	15: 39,876,158	S529P	probably damaging	Het
Mettl22	T	C	16: 8,482,157	V134A	probably damaging	Het
Morc2b	G	T	17: 33,136,112	H895Q	probably benign	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Nrxn3	A	G	12: 90,331,793	S1367G	possibly damaging	Het
Olfr129	A	G	17: 38,055,572	F7S	probably benign	Het
Olfr504	A	T	7: 108,565,616	S60T	probably benign	Het
Pcnx3	T	A	19: 5,685,701		probably null	Het
Pgap2	A	T	7: 102,237,448	M226L	probably damaging	Het
Pik3c2g	A	G	6: 139,896,072	I616M	probably damaging	Het
Pisd	A	G	5: 32,737,312	I380T	probably damaging	Het
Pkhd1	T	C	1: 20,350,521	I2454V	probably damaging	Het
Plpp2	A	G	10: 79,527,544	I151T	probably benign	Het
Polr3a	G	A	14: 24,452,200	T1295I	possibly damaging	Het
Pot1a	T	C	6: 25,748,284		probably benign	Het
Prpf39	T	G	12: 65,048,206	N219K	probably benign	Het
Rnf17	T	A	14: 56,475,447	N790K	probably damaging	Het
Slit3	C	T	11: 35,623,436		probably benign	Het
Stx1a	T	A	5: 135,041,234		probably benign	Het
Tenm3	C	A	8: 48,335,742	V690F	probably damaging	Het
Tmcc3	A	G	10: 94,578,771	I143V	probably benign	Het
Tmem41b	G	A	7: 109,981,049	S36F	probably damaging	Het
Trim5	A	T	7: 104,265,771	W364R	probably damaging	Het
Ttn	T	C	2: 76,786,811	Y16403C	probably damaging	Het
Vps8	T	C	16: 21,456,321	S210P	probably damaging	Het
Zbtb3	T	A	19: 8,803,457	S145T	possibly damaging	Het
Zfp882	T	A	8: 71,914,686	C452*	probably null	Het

Other mutations in Clcn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00782:Clcn3	APN	8	60922792	missense	probably damaging	0.99
IGL01088:Clcn3	APN	8	60937347	missense	probably damaging	1.00
IGL01449:Clcn3	APN	8	60934598	missense	probably damaging	0.97
IGL01792:Clcn3	APN	8	60929322	missense	probably damaging	1.00
IGL01845:Clcn3	APN	8	60913095	missense	probably benign	0.08
IGL01984:Clcn3	APN	8	60929580	missense	probably damaging	1.00
IGL02041:Clcn3	APN	8	60923153	missense	probably damaging	0.99
IGL02199:Clcn3	APN	8	60933092	nonsense	probably null
IGL02199:Clcn3	APN	8	60927274	missense	possibly damaging	0.82
IGL02456:Clcn3	APN	8	60941357	missense	probably damaging	1.00
IGL03353:Clcn3	APN	8	60922988	missense	probably benign	0.37
Precipice	UTSW	8	60941399	missense	probably benign	0.16
R0003:Clcn3	UTSW	8	60927296	nonsense	probably null
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0349:Clcn3	UTSW	8	60941348	missense	possibly damaging	0.91
R0437:Clcn3	UTSW	8	60934537	missense	possibly damaging	0.69
R0784:Clcn3	UTSW	8	60929203	missense	probably benign	0.25
R1167:Clcn3	UTSW	8	60922788	critical splice donor site	probably null
R2035:Clcn3	UTSW	8	60934598	missense	probably damaging	0.97
R2193:Clcn3	UTSW	8	60929187	missense	possibly damaging	0.56
R3697:Clcn3	UTSW	8	60913123	missense	probably benign	0.02
R3736:Clcn3	UTSW	8	60983652	unclassified	probably benign
R4676:Clcn3	UTSW	8	60930651	intron	probably benign
R4807:Clcn3	UTSW	8	60934530	missense	probably damaging	1.00
R5112:Clcn3	UTSW	8	60954552	missense	probably benign	0.07
R5200:Clcn3	UTSW	8	60923005	missense	probably damaging	0.99
R5652:Clcn3	UTSW	8	60919353	missense	possibly damaging	0.81
R5712:Clcn3	UTSW	8	60937298	critical splice donor site	probably null
R5731:Clcn3	UTSW	8	60922889	missense	possibly damaging	0.46
R5814:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6134:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6370:Clcn3	UTSW	8	60923024	missense	probably damaging	1.00
R6371:Clcn3	UTSW	8	60937335	missense	probably benign	0.06
R6394:Clcn3	UTSW	8	60941291	missense	probably damaging	0.99
R6466:Clcn3	UTSW	8	60929561	missense	probably damaging	1.00
R6588:Clcn3	UTSW	8	60914827	missense	probably benign	0.03
R6750:Clcn3	UTSW	8	60914775	missense	possibly damaging	0.93
R7522:Clcn3	UTSW	8	60941412	missense	probably benign
R7556:Clcn3	UTSW	8	60929487	missense	probably damaging	0.99
R7557:Clcn3	UTSW	8	60937368	missense	probably damaging	0.99
R7685:Clcn3	UTSW	8	60933085	missense	possibly damaging	0.54
R7887:Clcn3	UTSW	8	60941399	missense	probably benign	0.16
R8219:Clcn3	UTSW	8	60922966	missense	probably damaging	0.98
R8478:Clcn3	UTSW	8	60919488	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTTTCTCCTGGATTGTTAGCCAGC -3'
(R):5'- TGTGATAGCCTTCCCCAACCCATAC -3'

Sequencing Primer
(F):5'- gcaagaaagggaacataagcaaag -3'
(R):5'- TACACAAGGCTCAACACCAGTG -3'

Posted On

2013-10-16