Incidental Mutation 'R0840:Clcn3'
List |< first << previous [record 11 of 51] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Clcn3
Ensembl Gene ENSMUSG00000004319
Gene Namechloride channel, voltage-sensitive 3
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosomal Location60910389-60983300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60929154 bp
Amino Acid Change Valine to Phenylalanine at position 467 (V467F)
Ref Sequence ENSEMBL: ENSMUSP00000105931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]
Predicted Effect probably benign
Transcript: ENSMUST00000004430
AA Change: V494F

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: V494F

transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 1.4e-111 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 2.08e-8 SMART
low complexity region 847 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056508
AA Change: V467F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: V467F

transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.4e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093490
AA Change: V436F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: V436F

transmembrane domain 70 92 N/A INTRINSIC
Pfam:Voltage_CLC 162 565 1.2e-103 PFAM
CBS 609 659 2.46e-1 SMART
CBS 700 747 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110301
AA Change: V494F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: V494F

transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 2.7e-103 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110302
AA Change: V467F

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: V467F

transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.3e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 2.08e-8 SMART
low complexity region 820 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132234
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Clcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Clcn3 APN 8 60922792 missense probably damaging 0.99
IGL01088:Clcn3 APN 8 60937347 missense probably damaging 1.00
IGL01449:Clcn3 APN 8 60934598 missense probably damaging 0.97
IGL01792:Clcn3 APN 8 60929322 missense probably damaging 1.00
IGL01845:Clcn3 APN 8 60913095 missense probably benign 0.08
IGL01984:Clcn3 APN 8 60929580 missense probably damaging 1.00
IGL02041:Clcn3 APN 8 60923153 missense probably damaging 0.99
IGL02199:Clcn3 APN 8 60933092 nonsense probably null
IGL02199:Clcn3 APN 8 60927274 missense possibly damaging 0.82
IGL02456:Clcn3 APN 8 60941357 missense probably damaging 1.00
IGL03353:Clcn3 APN 8 60922988 missense probably benign 0.37
Precipice UTSW 8 60941399 missense probably benign 0.16
R0003:Clcn3 UTSW 8 60927296 nonsense probably null
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0349:Clcn3 UTSW 8 60941348 missense possibly damaging 0.91
R0437:Clcn3 UTSW 8 60934537 missense possibly damaging 0.69
R0784:Clcn3 UTSW 8 60929203 missense probably benign 0.25
R1167:Clcn3 UTSW 8 60922788 critical splice donor site probably null
R2035:Clcn3 UTSW 8 60934598 missense probably damaging 0.97
R2193:Clcn3 UTSW 8 60929187 missense possibly damaging 0.56
R3697:Clcn3 UTSW 8 60913123 missense probably benign 0.02
R3736:Clcn3 UTSW 8 60983652 unclassified probably benign
R4676:Clcn3 UTSW 8 60930651 intron probably benign
R4807:Clcn3 UTSW 8 60934530 missense probably damaging 1.00
R5112:Clcn3 UTSW 8 60954552 missense probably benign 0.07
R5200:Clcn3 UTSW 8 60923005 missense probably damaging 0.99
R5652:Clcn3 UTSW 8 60919353 missense possibly damaging 0.81
R5712:Clcn3 UTSW 8 60937298 critical splice donor site probably null
R5731:Clcn3 UTSW 8 60922889 missense possibly damaging 0.46
R5814:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6134:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6370:Clcn3 UTSW 8 60923024 missense probably damaging 1.00
R6371:Clcn3 UTSW 8 60937335 missense probably benign 0.06
R6394:Clcn3 UTSW 8 60941291 missense probably damaging 0.99
R6466:Clcn3 UTSW 8 60929561 missense probably damaging 1.00
R6588:Clcn3 UTSW 8 60914827 missense probably benign 0.03
R6750:Clcn3 UTSW 8 60914775 missense possibly damaging 0.93
R7522:Clcn3 UTSW 8 60941412 missense probably benign
R7556:Clcn3 UTSW 8 60929487 missense probably damaging 0.99
R7557:Clcn3 UTSW 8 60937368 missense probably damaging 0.99
R7685:Clcn3 UTSW 8 60933085 missense possibly damaging 0.54
R7887:Clcn3 UTSW 8 60941399 missense probably benign 0.16
R8219:Clcn3 UTSW 8 60922966 missense probably damaging 0.98
R8478:Clcn3 UTSW 8 60919488 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcaagaaagggaacataagcaaag -3'
Posted On2013-10-16