Incidental Mutation 'R0840:Zfp882'
ID77117
Institutional Source Beutler Lab
Gene Symbol Zfp882
Ensembl Gene ENSMUSG00000089857
Gene Namezinc finger protein 882
SynonymsENSMUSG00000052439
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71908608-71916354 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 71914686 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 452 (C452*)
Ref Sequence ENSEMBL: ENSMUSP00000105629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110002] [ENSMUST00000125802] [ENSMUST00000126607] [ENSMUST00000131544]
Predicted Effect probably null
Transcript: ENSMUST00000110002
AA Change: C452*
SMART Domains Protein: ENSMUSP00000105629
Gene: ENSMUSG00000089857
AA Change: C452*

DomainStartEndE-ValueType
KRAB 4 61 8.58e-14 SMART
ZnF_C2H2 84 106 1.47e-3 SMART
ZnF_C2H2 168 190 8.47e-4 SMART
ZnF_C2H2 196 218 2.27e-4 SMART
ZnF_C2H2 224 246 6.31e1 SMART
ZnF_C2H2 251 273 1.16e-1 SMART
ZnF_C2H2 279 301 1.25e-1 SMART
ZnF_C2H2 307 329 5.42e-2 SMART
ZnF_C2H2 335 357 1.47e-3 SMART
ZnF_C2H2 363 385 7.26e-3 SMART
ZnF_C2H2 391 413 1.26e-2 SMART
ZnF_C2H2 419 441 3.29e1 SMART
ZnF_C2H2 447 469 2.67e-1 SMART
ZnF_C2H2 475 497 1.04e-3 SMART
ZnF_C2H2 503 525 4.11e-2 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118290
Predicted Effect probably benign
Transcript: ENSMUST00000125802
SMART Domains Protein: ENSMUSP00000121316
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 12 69 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126607
SMART Domains Protein: ENSMUSP00000119978
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 44 101 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131544
SMART Domains Protein: ENSMUSP00000120213
Gene: ENSMUSG00000066880

DomainStartEndE-ValueType
KRAB 4 56 1.08e-10 SMART
ZnF_C2H2 167 189 8.47e-4 SMART
ZnF_C2H2 195 217 8.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170898
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Other mutations in Zfp882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Zfp882 APN 8 71913827 missense probably benign
R0244:Zfp882 UTSW 8 71913523 missense possibly damaging 0.79
R0270:Zfp882 UTSW 8 71914615 missense probably benign 0.05
R0636:Zfp882 UTSW 8 71914337 missense probably benign 0.01
R1299:Zfp882 UTSW 8 71913473 missense probably damaging 1.00
R4439:Zfp882 UTSW 8 71913609 missense probably damaging 0.97
R4829:Zfp882 UTSW 8 71914389 missense probably damaging 1.00
R5028:Zfp882 UTSW 8 71914654 missense possibly damaging 0.70
R5296:Zfp882 UTSW 8 71914360 missense probably damaging 1.00
R5882:Zfp882 UTSW 8 71913459 critical splice acceptor site probably null
R5974:Zfp882 UTSW 8 71913155 missense probably damaging 1.00
R6052:Zfp882 UTSW 8 71914505 missense probably benign 0.01
R6383:Zfp882 UTSW 8 71914640 missense probably damaging 1.00
R6888:Zfp882 UTSW 8 71914286 missense probably benign 0.01
R6987:Zfp882 UTSW 8 71914673 missense probably benign 0.01
R7045:Zfp882 UTSW 8 71913249 critical splice donor site probably null
R7780:Zfp882 UTSW 8 71914229 missense possibly damaging 0.89
R7793:Zfp882 UTSW 8 71913141 missense probably damaging 1.00
R8386:Zfp882 UTSW 8 71914118 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGATACCATGAACAGATTCACAGGGG -3'
(R):5'- CAACGTGGCTTACACACAGTGC -3'

Sequencing Primer
(F):5'- ATGGCTGTAAGCAGTGTGG -3'
(R):5'- tgtttacatacatacggtttctctc -3'
Posted On2013-10-16