Incidental Mutation 'R0840:Irf8'
ID77118
Institutional Source Beutler Lab
Gene Symbol Irf8
Ensembl Gene ENSMUSG00000041515
Gene Nameinterferon regulatory factor 8
SynonymsIcsbp1, ICSBP, Myls, IRF-8
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location120736358-120756694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120753481 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 153 (G153S)
Ref Sequence ENSEMBL: ENSMUSP00000125447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047737] [ENSMUST00000127664] [ENSMUST00000160943] [ENSMUST00000162001] [ENSMUST00000162658]
Predicted Effect probably benign
Transcript: ENSMUST00000047737
AA Change: G244S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040245
Gene: ENSMUSG00000041515
AA Change: G244S

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160594
Predicted Effect probably benign
Transcript: ENSMUST00000160943
AA Change: G153S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125447
Gene: ENSMUSG00000041515
AA Change: G153S

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
IRF-3 111 289 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162001
AA Change: G244S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125029
Gene: ENSMUSG00000041515
AA Change: G244S

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162658
SMART Domains Protein: ENSMUSP00000125443
Gene: ENSMUSG00000041515

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
Pfam:IRF-3 111 151 4.7e-9 PFAM
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcription factor that belongs to the interferon regulatory factor family. Proteins belonging to this family have a DNA binding domain at the amino terminus that contains five well-conserved tryptophan-rich repeats. This domain recognizes DNA sequences similar to the interferon-stimulated response element. The protein encoded by this gene promotes or suppresses lineage-specific genes to regulate the differentation of lymphoid and myeloid lineage cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased incidence of viral infections, shortened life span, deregulated hematopoiesis, and hematological neoplasias. Heterozygotes show similar, but milder, phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Irf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Irf8 APN 8 120753380 missense probably damaging 1.00
IGL02944:Irf8 APN 8 120755125 missense probably benign 0.00
IGL03024:Irf8 APN 8 120753358 missense probably damaging 0.98
gemini UTSW 8 120743883 nonsense probably null
gemini2 UTSW 8 120753707 missense probably damaging 0.97
glenn UTSW 8 120739842 missense probably damaging 1.00
ANU74:Irf8 UTSW 8 120739869 missense possibly damaging 0.75
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R1622:Irf8 UTSW 8 120739822 missense possibly damaging 0.86
R1715:Irf8 UTSW 8 120754388 missense probably damaging 0.98
R2274:Irf8 UTSW 8 120753527 missense probably damaging 0.99
R2875:Irf8 UTSW 8 120754463 missense probably damaging 1.00
R3743:Irf8 UTSW 8 120753571 missense probably damaging 1.00
R4209:Irf8 UTSW 8 120753469 missense probably damaging 0.99
R4729:Irf8 UTSW 8 120753439 missense probably damaging 0.99
R6343:Irf8 UTSW 8 120753707 missense probably damaging 0.97
R6950:Irf8 UTSW 8 120755125 missense probably benign 0.00
R7051:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7052:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7249:Irf8 UTSW 8 120739832 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAATGCATGTTCACACCTGTGCTC -3'
(R):5'- TGGTGTCAAAGACCTGCACCAC -3'

Sequencing Primer
(F):5'- gagattaccagcaaacagcac -3'
(R):5'- GACCTGCACCACCTCGTC -3'
Posted On2013-10-16