Incidental Mutation 'R0840:Plpp2'
ID77122
Institutional Source Beutler Lab
Gene Symbol Plpp2
Ensembl Gene ENSMUSG00000052151
Gene Namephospholipid phosphatase 2
SynonymsLpp2, Ppap2c
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79526430-79533796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79527544 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 151 (I151T)
Ref Sequence ENSEMBL: ENSMUSP00000133247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063879] [ENSMUST00000165233] [ENSMUST00000166804] [ENSMUST00000218241]
Predicted Effect probably benign
Transcript: ENSMUST00000063879
AA Change: I207T

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069670
Gene: ENSMUSG00000052151
AA Change: I207T

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
Blast:acidPPc 21 70 6e-9 BLAST
acidPPc 99 239 1.42e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163602
Predicted Effect probably benign
Transcript: ENSMUST00000165233
SMART Domains Protein: ENSMUSP00000127000
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166804
AA Change: I151T

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133247
Gene: ENSMUSG00000052151
AA Change: I151T

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
acidPPc 43 183 1.42e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184212
Predicted Effect probably benign
Transcript: ENSMUST00000218241
AA Change: I89T

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Plpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Plpp2 APN 10 79527493 missense probably damaging 1.00
IGL03327:Plpp2 APN 10 79530984 splice site probably null
Trust UTSW 10 79530929 missense probably damaging 1.00
R0009:Plpp2 UTSW 10 79527244 missense probably benign 0.01
R0056:Plpp2 UTSW 10 79527229 missense probably damaging 0.99
R0097:Plpp2 UTSW 10 79530537 missense possibly damaging 0.50
R0311:Plpp2 UTSW 10 79527580 missense probably damaging 0.97
R1406:Plpp2 UTSW 10 79530777 splice site probably benign
R1642:Plpp2 UTSW 10 79530684 missense probably damaging 1.00
R3436:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R3437:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R4400:Plpp2 UTSW 10 79527493 missense possibly damaging 0.88
R4521:Plpp2 UTSW 10 79530625 missense probably damaging 1.00
R4873:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R4875:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R5114:Plpp2 UTSW 10 79527139 missense probably benign 0.41
R6970:Plpp2 UTSW 10 79530546 missense possibly damaging 0.90
R7383:Plpp2 UTSW 10 79531007 missense probably null 0.99
R7902:Plpp2 UTSW 10 79527544 missense possibly damaging 0.91
R7953:Plpp2 UTSW 10 79530540 missense possibly damaging 0.89
R8237:Plpp2 UTSW 10 79527460 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAGGGTGTTCATAGCAGCTAGGG -3'
(R):5'- CTACTGCACAATGGGGTATGTGGAG -3'

Sequencing Primer
(F):5'- TCTGAAACATAGCGGACCTG -3'
(R):5'- GGAGGCACTAAGGGTCGC -3'
Posted On2013-10-16