Incidental Mutation 'R0840:Bsg'
ID77123
Institutional Source Beutler Lab
Gene Symbol Bsg
Ensembl Gene ENSMUSG00000023175
Gene Namebasigin
SynonymsEMMPRIN, 5A11/Basigin, CD147, neurothelin, gp 42, HT-7
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0840 (G1)
Quality Score222
Status Validated
Chromosome10
Chromosomal Location79704491-79711969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79709685 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 28 (T28A)
Ref Sequence ENSEMBL: ENSMUSP00000136487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067036] [ENSMUST00000105381] [ENSMUST00000179781]
Predicted Effect probably benign
Transcript: ENSMUST00000067036
AA Change: T144A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070751
Gene: ENSMUSG00000023175
AA Change: T144A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
IGc2 35 115 5.75e-4 SMART
IG 227 323 1.27e-5 SMART
transmembrane domain 327 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105381
SMART Domains Protein: ENSMUSP00000101020
Gene: ENSMUSG00000023175

DomainStartEndE-ValueType
Blast:IG_like 1 46 7e-12 BLAST
IG 56 152 1.27e-5 SMART
transmembrane domain 156 178 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000178383
AA Change: T10A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179201
Predicted Effect probably damaging
Transcript: ENSMUST00000179781
AA Change: T28A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136487
Gene: ENSMUSG00000023175
AA Change: T28A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Blast:IG_like 26 97 1e-24 BLAST
IG 111 207 1.27e-5 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180235
Meta Mutation Damage Score 0.1495 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. The encoded protein is also a member of the immunoglobulin superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mutants die near the time of implantation. Half of the survivors die prior to 1 month of age from interstitial pneumonia. The remaining mice are small, sterile, have retinal abnormalities, and perform poorly in behavioral tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Bsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Bsg APN 10 79711514 missense probably benign 0.01
IGL01912:Bsg APN 10 79710140 missense probably null 1.00
R1665:Bsg UTSW 10 79711518 missense probably damaging 1.00
R5119:Bsg UTSW 10 79710223 intron probably benign
R5397:Bsg UTSW 10 79708795 missense probably damaging 1.00
R6208:Bsg UTSW 10 79708838 missense probably damaging 1.00
R7384:Bsg UTSW 10 79709797 missense probably damaging 0.98
R8048:Bsg UTSW 10 79709746 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCGCTCTGACTGTCTACTGCAAAC -3'
(R):5'- TCTCACGCTATACAGGTAAGGCCAC -3'

Sequencing Primer
(F):5'- TTCTGAGTGACGGTCAGATAAC -3'
(R):5'- AGCCAATCCAGAGCTGTGTG -3'
Posted On2013-10-16