Incidental Mutation 'R0840:Tmcc3'
ID77124
Institutional Source Beutler Lab
Gene Symbol Tmcc3
Ensembl Gene ENSMUSG00000020023
Gene Nametransmembrane and coiled coil domains 3
Synonyms
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location94311949-94590956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94578771 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 143 (I143V)
Ref Sequence ENSEMBL: ENSMUSP00000063264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065060] [ENSMUST00000117460] [ENSMUST00000117929] [ENSMUST00000121471] [ENSMUST00000132743] [ENSMUST00000148823] [ENSMUST00000148910]
Predicted Effect probably benign
Transcript: ENSMUST00000065060
AA Change: I143V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063264
Gene: ENSMUSG00000020023
AA Change: I143V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 65 465 1.2e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117460
AA Change: I112V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112669
Gene: ENSMUSG00000020023
AA Change: I112V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117929
AA Change: I112V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112401
Gene: ENSMUSG00000020023
AA Change: I112V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121471
AA Change: I112V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113122
Gene: ENSMUSG00000020023
AA Change: I112V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132743
AA Change: I112V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000119751
Gene: ENSMUSG00000020023
AA Change: I112V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 47 134 3.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146744
Predicted Effect probably benign
Transcript: ENSMUST00000148823
AA Change: I112V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000119496
Gene: ENSMUSG00000020023
AA Change: I112V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 85 210 3.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148910
SMART Domains Protein: ENSMUSP00000121456
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 34 76 1.6e-15 PFAM
Meta Mutation Damage Score 0.1030 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Tmcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Tmcc3 APN 10 94582285 missense probably damaging 1.00
IGL01455:Tmcc3 APN 10 94586755 missense probably damaging 0.97
IGL02376:Tmcc3 APN 10 94578567 missense possibly damaging 0.85
IGL03073:Tmcc3 APN 10 94578951 missense probably benign 0.40
IGL03348:Tmcc3 APN 10 94579080 missense possibly damaging 0.95
R0131:Tmcc3 UTSW 10 94545575 splice site probably benign
R0360:Tmcc3 UTSW 10 94578545 missense probably benign
R1994:Tmcc3 UTSW 10 94578606 missense possibly damaging 0.95
R1995:Tmcc3 UTSW 10 94578606 missense possibly damaging 0.95
R2184:Tmcc3 UTSW 10 94582306 missense probably damaging 1.00
R2197:Tmcc3 UTSW 10 94578918 missense probably damaging 1.00
R2273:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R2274:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R3763:Tmcc3 UTSW 10 94579317 missense probably benign 0.42
R4690:Tmcc3 UTSW 10 94545557 utr 5 prime probably benign
R4763:Tmcc3 UTSW 10 94579311 missense probably damaging 1.00
R4816:Tmcc3 UTSW 10 94578784 missense possibly damaging 0.89
R5385:Tmcc3 UTSW 10 94579153 missense probably damaging 1.00
R6177:Tmcc3 UTSW 10 94582387 missense probably damaging 0.97
R6636:Tmcc3 UTSW 10 94578424 missense probably benign 0.14
R6898:Tmcc3 UTSW 10 94551172 splice site probably null
R7128:Tmcc3 UTSW 10 94430634 start gained probably benign
R7313:Tmcc3 UTSW 10 94430572 start gained probably benign
R7320:Tmcc3 UTSW 10 94578495 missense possibly damaging 0.94
R7456:Tmcc3 UTSW 10 94582312 missense possibly damaging 0.79
R7874:Tmcc3 UTSW 10 94551027 critical splice donor site probably null
R7876:Tmcc3 UTSW 10 94578535 missense probably benign 0.03
R8098:Tmcc3 UTSW 10 94579216 missense probably benign 0.00
R8274:Tmcc3 UTSW 10 94586876 missense probably damaging 1.00
R8276:Tmcc3 UTSW 10 94582308 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACTCAATGCGGACAGCCTGAGAC -3'
(R):5'- AGTGAGCAATGTTATCTGCACTGCC -3'

Sequencing Primer
(F):5'- TCTTAAAGGTGACGGAGCAG -3'
(R):5'- AGTTGGCAAACTCTCTGGAC -3'
Posted On2013-10-16