Incidental Mutation 'R0840:Fnip1'
ID77126
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
MMRRC Submission 039019-MU
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R0840 (G1)
Quality Score210
Status Validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 54493181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]
Predicted Effect probably benign
Transcript: ENSMUST00000046835
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143650
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54515499 missense probably benign 0.41
R7866:Fnip1 UTSW 11 54465402 start gained probably benign
R7939:Fnip1 UTSW 11 54502267 missense probably damaging 1.00
R7943:Fnip1 UTSW 11 54502388 missense probably damaging 1.00
R8429:Fnip1 UTSW 11 54475696 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTTCATGACTCAGGCTGGGCAG -3'
(R):5'- GCAGCTCCTGGAGCAGATTGTAAAG -3'

Sequencing Primer
(F):5'- GGTTCAGAAACTTCATGTTTCCG -3'
(R):5'- TCATGTGGCTTTCAAAGAGAGG -3'
Posted On2013-10-16