Mutagenetix > Incidental Mutations

Incidental Mutation 'R0840:Fnip1'

List |< first << previous [record 18 of 51] next >> last >|

77126

Institutional Source

Beutler Lab

Gene Symbol

Fnip1

Ensembl Gene

ENSMUSG00000035992

Gene Name

folliculin interacting protein 1

Synonyms

A730024A03Rik

MMRRC Submission

039019-MU

Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene?

Possibly essential (E-score: 0.634) question?

Stock #

R0840 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

54438199-54518235 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 54493181 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]

Predicted Effect

probably benign
Transcript: ENSMUST00000046835

SMART Domains

Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143650

SMART Domains

Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810020O05Rik	G	T	6: 87,680,278		noncoding transcript	Het
2700049A03Rik	C	G	12: 71,158,883	Q434E	probably benign	Het
A930011G23Rik	T	C	5: 99,234,688	T234A	probably benign	Het
Acot5	G	A	12: 84,075,840	W399*	probably null	Het
Adra1a	A	G	14: 66,727,710	E383G	possibly damaging	Het
Ahnak	T	A	19: 9,005,063	I1237N	probably damaging	Het
Bsg	A	G	10: 79,709,685	T28A	probably damaging	Het
Cacna1i	A	T	15: 80,358,949	I436F	possibly damaging	Het
Cd109	T	C	9: 78,664,330	I417T	probably benign	Het
Cep295	A	T	9: 15,334,315	D948E	probably benign	Het
Clcn3	C	A	8: 60,929,154	V467F	probably benign	Het
Cntnap3	T	C	13: 64,787,910	S380G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dll4	T	A	2: 119,326,485	N79K	probably benign	Het
Ep300	A	T	15: 81,644,933	N1558I	unknown	Het
Fblim1	A	G	4: 141,581,009	F330L	possibly damaging	Het
Fbxo46	T	A	7: 19,137,148	M564K	possibly damaging	Het
Foxl2	A	T	9: 98,955,931	K91*	probably null	Het
Gapvd1	C	A	2: 34,729,113	V83F	probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
Irf8	G	A	8: 120,753,481	G153S	probably benign	Het
Kcnu1	T	A	8: 25,913,684	M1K	probably null	Het
Krt32	G	A	11: 100,081,242	P427S	probably benign	Het
Lrp12	A	G	15: 39,876,158	S529P	probably damaging	Het
Mettl22	T	C	16: 8,482,157	V134A	probably damaging	Het
Morc2b	G	T	17: 33,136,112	H895Q	probably benign	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Nrxn3	A	G	12: 90,331,793	S1367G	possibly damaging	Het
Olfr129	A	G	17: 38,055,572	F7S	probably benign	Het
Olfr504	A	T	7: 108,565,616	S60T	probably benign	Het
Pcnx3	T	A	19: 5,685,701		probably null	Het
Pgap2	A	T	7: 102,237,448	M226L	probably damaging	Het
Pik3c2g	A	G	6: 139,896,072	I616M	probably damaging	Het
Pisd	A	G	5: 32,737,312	I380T	probably damaging	Het
Pkhd1	T	C	1: 20,350,521	I2454V	probably damaging	Het
Plpp2	A	G	10: 79,527,544	I151T	probably benign	Het
Polr3a	G	A	14: 24,452,200	T1295I	possibly damaging	Het
Pot1a	T	C	6: 25,748,284		probably benign	Het
Prpf39	T	G	12: 65,048,206	N219K	probably benign	Het
Rnf17	T	A	14: 56,475,447	N790K	probably damaging	Het
Slit3	C	T	11: 35,623,436		probably benign	Het
Stx1a	T	A	5: 135,041,234		probably benign	Het
Tenm3	C	A	8: 48,335,742	V690F	probably damaging	Het
Tmcc3	A	G	10: 94,578,771	I143V	probably benign	Het
Tmem41b	G	A	7: 109,981,049	S36F	probably damaging	Het
Trim5	A	T	7: 104,265,771	W364R	probably damaging	Het
Ttn	T	C	2: 76,786,811	Y16403C	probably damaging	Het
Vps8	T	C	16: 21,456,321	S210P	probably damaging	Het
Zbtb3	T	A	19: 8,803,457	S145T	possibly damaging	Het
Zfp882	T	A	8: 71,914,686	C452*	probably null	Het

Other mutations in Fnip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01449:Fnip1	APN	11	54499508	missense	probably damaging	1.00
IGL01590:Fnip1	APN	11	54493300	missense	probably damaging	1.00
IGL01959:Fnip1	APN	11	54490912	missense	possibly damaging	0.95
IGL02157:Fnip1	APN	11	54487763	missense	probably damaging	1.00
IGL02197:Fnip1	APN	11	54493374	missense	probably damaging	1.00
IGL02476:Fnip1	APN	11	54499567	splice site	probably benign
IGL02639:Fnip1	APN	11	54475640	nonsense	probably null
IGL02742:Fnip1	APN	11	54493351	missense	probably damaging	1.00
hamel	UTSW	11	54480685	critical splice donor site	probably benign
hamel2	UTSW	11	54502271	missense	probably damaging	1.00
Normandy	UTSW	11	54493181	splice site	probably benign
H8562:Fnip1	UTSW	11	54480297	missense	probably damaging	0.98
P0043:Fnip1	UTSW	11	54503225	missense	probably benign	0.00
R0114:Fnip1	UTSW	11	54487801	splice site	probably benign
R0278:Fnip1	UTSW	11	54489343	splice site	probably null
R0409:Fnip1	UTSW	11	54480354	splice site	probably null
R1131:Fnip1	UTSW	11	54493303	missense	possibly damaging	0.82
R1205:Fnip1	UTSW	11	54502306	missense	possibly damaging	0.91
R1271:Fnip1	UTSW	11	54503297	missense	probably benign
R1817:Fnip1	UTSW	11	54502453	missense	probably benign	0.30
R1826:Fnip1	UTSW	11	54466164	missense	probably damaging	1.00
R1872:Fnip1	UTSW	11	54487735	missense	probably damaging	1.00
R1883:Fnip1	UTSW	11	54515547	missense	probably damaging	1.00
R1917:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1918:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1919:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R2010:Fnip1	UTSW	11	54482503	missense	probably damaging	1.00
R2117:Fnip1	UTSW	11	54500624	missense	probably damaging	1.00
R2329:Fnip1	UTSW	11	54466107	missense	probably damaging	0.98
R2337:Fnip1	UTSW	11	54475737	missense	probably damaging	0.98
R2850:Fnip1	UTSW	11	54502677	missense	probably benign	0.32
R2863:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2864:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2865:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R3936:Fnip1	UTSW	11	54480239	splice site	probably null
R4017:Fnip1	UTSW	11	54509987	missense	probably benign	0.14
R4033:Fnip1	UTSW	11	54502471	missense	probably benign	0.02
R4668:Fnip1	UTSW	11	54503559	missense	probably damaging	1.00
R4695:Fnip1	UTSW	11	54499419	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54466171	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54499526	missense	probably benign	0.01
R4777:Fnip1	UTSW	11	54500556	missense	probably damaging	1.00
R4863:Fnip1	UTSW	11	54515556	missense	possibly damaging	0.52
R5369:Fnip1	UTSW	11	54502589	missense	probably benign
R5481:Fnip1	UTSW	11	54502644	missense	probably benign	0.01
R5562:Fnip1	UTSW	11	54489342	critical splice donor site	probably null
R5563:Fnip1	UTSW	11	54504862	missense	probably benign	0.05
R5628:Fnip1	UTSW	11	54503633	missense	probably benign	0.08
R5689:Fnip1	UTSW	11	54502289	missense	probably damaging	1.00
R6009:Fnip1	UTSW	11	54502271	missense	probably damaging	1.00
R6120:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R6429:Fnip1	UTSW	11	54515567	missense	probably damaging	1.00
R6546:Fnip1	UTSW	11	54502611	missense	probably benign	0.03
R6600:Fnip1	UTSW	11	54503099	missense	probably benign
R6882:Fnip1	UTSW	11	54509898	missense	probably damaging	1.00
R6966:Fnip1	UTSW	11	54482559	missense	probably benign	0.00
R7009:Fnip1	UTSW	11	54502935	missense	probably damaging	1.00
R7664:Fnip1	UTSW	11	54466125	missense	probably damaging	1.00
R7706:Fnip1	UTSW	11	54515499	missense	probably benign	0.41
R7866:Fnip1	UTSW	11	54465402	start gained	probably benign
R7939:Fnip1	UTSW	11	54502267	missense	probably damaging	1.00
R7943:Fnip1	UTSW	11	54502388	missense	probably damaging	1.00
R8429:Fnip1	UTSW	11	54475696	missense	possibly damaging	0.94
R8546:Fnip1	UTSW	11	54510000	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TTTTCATGACTCAGGCTGGGCAG -3'
(R):5'- GCAGCTCCTGGAGCAGATTGTAAAG -3'

Sequencing Primer
(F):5'- GGTTCAGAAACTTCATGTTTCCG -3'
(R):5'- TCATGTGGCTTTCAAAGAGAGG -3'

Posted On

2013-10-16