Incidental Mutation 'R0840:Guk1'
ID77127
Institutional Source Beutler Lab
Gene Symbol Guk1
Ensembl Gene ENSMUSG00000020444
Gene Nameguanylate kinase 1
Synonyms
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59183875-59192212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59185095 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 146 (R146C)
Ref Sequence ENSEMBL: ENSMUSP00000130214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108790] [ENSMUST00000108793] [ENSMUST00000170202] [ENSMUST00000170895] [ENSMUST00000172714]
Predicted Effect probably benign
Transcript: ENSMUST00000108790
SMART Domains Protein: ENSMUSP00000104418
Gene: ENSMUSG00000043448

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108793
SMART Domains Protein: ENSMUSP00000104421
Gene: ENSMUSG00000043448

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154386
Predicted Effect probably damaging
Transcript: ENSMUST00000170202
AA Change: R158C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127566
Gene: ENSMUSG00000020444
AA Change: R158C

DomainStartEndE-ValueType
GuKc 24 210 1.36e-94 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170895
AA Change: R146C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130214
Gene: ENSMUSG00000020444
AA Change: R146C

DomainStartEndE-ValueType
GuKc 12 198 1.36e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172714
Meta Mutation Damage Score 0.5896 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Adra1a A G 14: 66,727,710 E383G possibly damaging Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Guk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Guk1 UTSW 11 59186028 missense probably damaging 0.96
R0838:Guk1 UTSW 11 59185095 missense probably damaging 1.00
R0839:Guk1 UTSW 11 59185095 missense probably damaging 1.00
R1586:Guk1 UTSW 11 59186849 missense probably damaging 1.00
R1729:Guk1 UTSW 11 59185312 missense probably damaging 1.00
R1784:Guk1 UTSW 11 59185312 missense probably damaging 1.00
R1795:Guk1 UTSW 11 59186813 missense probably benign 0.05
R7411:Guk1 UTSW 11 59185985 missense
R7446:Guk1 UTSW 11 59186024 missense probably benign 0.31
RF018:Guk1 UTSW 11 59186408 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGAATGTGGACCAAGCTCAGACCC -3'
(R):5'- AGTTTCTCTGAAGCTCTCGAAAGCC -3'

Sequencing Primer
(F):5'- TCAGTAAACAAGTGTGGCCTCTC -3'
(R):5'- TCCCAGCAAGGAAGCTGTTC -3'
Posted On2013-10-16