Mutagenetix > Incidental Mutations

Incidental Mutation 'R0840:Nrxn3'

List |< first << previous [record 29 of 51] next >> last >|

77132

Institutional Source

Beutler Lab

Gene Symbol

Nrxn3

Ensembl Gene

ENSMUSG00000066392

Gene Name

neurexin III

Synonyms

4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta

MMRRC Submission

039019-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88722876-90334935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 90331793 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1367 (S1367G)

Ref Sequence

ENSEMBL: ENSMUSP00000129678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000110130] [ENSMUST00000110133] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]

Predicted Effect

probably benign
Transcript: ENSMUST00000057634

SMART Domains

Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	94	246	3.28e-41	SMART
EGF	273	307	4.1e-2	SMART
LamG	332	470	4.87e-26	SMART
LamG	518	654	7.08e-37	SMART
EGF	688	722	1.99e1	SMART
LamG	750	907	1.14e-17	SMART
low complexity region	948	964	N/A	INTRINSIC
low complexity region	1028	1043	N/A	INTRINSIC
4.1m	1046	1064	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110130
AA Change: S363G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000105757
Gene: ENSMUSG00000066392
AA Change: S363G

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamG	107	264	1.14e-17	SMART
Blast:LamG	294	410	6e-47	BLAST
low complexity region	492	507	N/A	INTRINSIC
4.1m	510	528	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110133

SMART Domains

Protein: ENSMUSP00000105760
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamG	107	234	1.8e-20	SMART
Blast:LamG	264	330	1e-19	BLAST
low complexity region	358	373	N/A	INTRINSIC
4.1m	376	394	4.38e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163134
AA Change: S1367G

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: S1367G

Domain	Start	End	E-Value	Type
LamG	47	184	9.8e-31	SMART
EGF	201	235	8.07e-1	SMART
LamG	279	413	7.19e-38	SMART
LamG	467	619	3.28e-41	SMART
EGF	646	680	4.1e-2	SMART
LamG	705	843	4.87e-26	SMART
LamG	891	1027	7.08e-37	SMART
EGF	1052	1086	1.99e1	SMART
LamG	1114	1271	1.14e-17	SMART
low complexity region	1312	1328	N/A	INTRINSIC
low complexity region	1395	1406	N/A	INTRINSIC
low complexity region	1499	1514	N/A	INTRINSIC
4.1m	1517	1535	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167103

SMART Domains

Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	47	184	9.8e-31	SMART
EGF	201	235	8.07e-1	SMART
LamG	279	413	7.19e-38	SMART
LamG	467	619	3.28e-41	SMART
EGF	646	680	4.1e-2	SMART
LamG	705	834	5.76e-28	SMART
LamG	882	1018	7.08e-37	SMART
EGF	1043	1077	1.99e1	SMART
LamG	1105	1262	1.14e-17	SMART
low complexity region	1303	1319	N/A	INTRINSIC
low complexity region	1354	1382	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167887

SMART Domains

Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	94	246	3.28e-41	SMART
EGF	273	307	4.1e-2	SMART
LamG	332	470	4.87e-26	SMART
LamG	518	654	7.08e-37	SMART
EGF	688	722	1.99e1	SMART
LamG	750	907	1.14e-17	SMART
low complexity region	948	964	N/A	INTRINSIC
low complexity region	1028	1043	N/A	INTRINSIC
4.1m	1046	1064	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190626

SMART Domains

Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	94	246	2.1e-43	SMART
EGF	273	307	2e-4	SMART
LamG	332	470	3.1e-28	SMART
LamG	518	654	4.4e-39	SMART
EGF	688	722	9.6e-2	SMART
LamG	750	877	1.1e-22	SMART
low complexity region	918	934	N/A	INTRINSIC
low complexity region	972	1000	N/A	INTRINSIC

Meta Mutation Damage Score

0.1018

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810020O05Rik	G	T	6: 87,680,278		noncoding transcript	Het
2700049A03Rik	C	G	12: 71,158,883	Q434E	probably benign	Het
A930011G23Rik	T	C	5: 99,234,688	T234A	probably benign	Het
Acot5	G	A	12: 84,075,840	W399*	probably null	Het
Adra1a	A	G	14: 66,727,710	E383G	possibly damaging	Het
Ahnak	T	A	19: 9,005,063	I1237N	probably damaging	Het
Bsg	A	G	10: 79,709,685	T28A	probably damaging	Het
Cacna1i	A	T	15: 80,358,949	I436F	possibly damaging	Het
Cd109	T	C	9: 78,664,330	I417T	probably benign	Het
Cep295	A	T	9: 15,334,315	D948E	probably benign	Het
Clcn3	C	A	8: 60,929,154	V467F	probably benign	Het
Cntnap3	T	C	13: 64,787,910	S380G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dll4	T	A	2: 119,326,485	N79K	probably benign	Het
Ep300	A	T	15: 81,644,933	N1558I	unknown	Het
Fblim1	A	G	4: 141,581,009	F330L	possibly damaging	Het
Fbxo46	T	A	7: 19,137,148	M564K	possibly damaging	Het
Fnip1	T	A	11: 54,493,181		probably benign	Het
Foxl2	A	T	9: 98,955,931	K91*	probably null	Het
Gapvd1	C	A	2: 34,729,113	V83F	probably benign	Het
Guk1	G	A	11: 59,185,095	R146C	probably damaging	Het
Irf8	G	A	8: 120,753,481	G153S	probably benign	Het
Kcnu1	T	A	8: 25,913,684	M1K	probably null	Het
Krt32	G	A	11: 100,081,242	P427S	probably benign	Het
Lrp12	A	G	15: 39,876,158	S529P	probably damaging	Het
Mettl22	T	C	16: 8,482,157	V134A	probably damaging	Het
Morc2b	G	T	17: 33,136,112	H895Q	probably benign	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Olfr129	A	G	17: 38,055,572	F7S	probably benign	Het
Olfr504	A	T	7: 108,565,616	S60T	probably benign	Het
Pcnx3	T	A	19: 5,685,701		probably null	Het
Pgap2	A	T	7: 102,237,448	M226L	probably damaging	Het
Pik3c2g	A	G	6: 139,896,072	I616M	probably damaging	Het
Pisd	A	G	5: 32,737,312	I380T	probably damaging	Het
Pkhd1	T	C	1: 20,350,521	I2454V	probably damaging	Het
Plpp2	A	G	10: 79,527,544	I151T	probably benign	Het
Polr3a	G	A	14: 24,452,200	T1295I	possibly damaging	Het
Pot1a	T	C	6: 25,748,284		probably benign	Het
Prpf39	T	G	12: 65,048,206	N219K	probably benign	Het
Rnf17	T	A	14: 56,475,447	N790K	probably damaging	Het
Slit3	C	T	11: 35,623,436		probably benign	Het
Stx1a	T	A	5: 135,041,234		probably benign	Het
Tenm3	C	A	8: 48,335,742	V690F	probably damaging	Het
Tmcc3	A	G	10: 94,578,771	I143V	probably benign	Het
Tmem41b	G	A	7: 109,981,049	S36F	probably damaging	Het
Trim5	A	T	7: 104,265,771	W364R	probably damaging	Het
Ttn	T	C	2: 76,786,811	Y16403C	probably damaging	Het
Vps8	T	C	16: 21,456,321	S210P	probably damaging	Het
Zbtb3	T	A	19: 8,803,457	S145T	possibly damaging	Het
Zfp882	T	A	8: 71,914,686	C452*	probably null	Het

Other mutations in Nrxn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrxn3	APN	12	90204592	missense	probably damaging	1.00
IGL00961:Nrxn3	APN	12	90204546	missense	possibly damaging	0.95
IGL01073:Nrxn3	APN	12	89254740	missense	probably benign	0.25
IGL01338:Nrxn3	APN	12	89255034	missense	possibly damaging	0.86
IGL01377:Nrxn3	APN	12	89533012	critical splice donor site	probably null
IGL01409:Nrxn3	APN	12	89510358	missense	probably damaging	1.00
IGL01764:Nrxn3	APN	12	90204750	missense	possibly damaging	0.48
IGL02063:Nrxn3	APN	12	88795795	missense	possibly damaging	0.86
IGL02171:Nrxn3	APN	12	89193163	missense	probably damaging	1.00
IGL02309:Nrxn3	APN	12	89976407	missense	probably damaging	0.99
IGL02340:Nrxn3	APN	12	90204628	missense	possibly damaging	0.82
IGL02343:Nrxn3	APN	12	88795353	missense	probably damaging	1.00
IGL02600:Nrxn3	APN	12	89511912	splice site	probably benign
IGL02735:Nrxn3	APN	12	89254854	missense	probably benign	0.16
IGL03061:Nrxn3	APN	12	89511928	nonsense	probably null
IGL03206:Nrxn3	APN	12	89260508	missense	possibly damaging	0.88
IGL03337:Nrxn3	APN	12	89255020	missense	probably damaging	1.00
R0098:Nrxn3	UTSW	12	89260201	missense	probably damaging	1.00
R0098:Nrxn3	UTSW	12	89260201	missense	probably damaging	1.00
R0144:Nrxn3	UTSW	12	89348392	missense	probably damaging	1.00
R0334:Nrxn3	UTSW	12	89813642	critical splice donor site	probably null
R0531:Nrxn3	UTSW	12	88795342	missense	probably damaging	1.00
R1324:Nrxn3	UTSW	12	89254696	missense	possibly damaging	0.89
R1438:Nrxn3	UTSW	12	90332135	missense	probably damaging	1.00
R1484:Nrxn3	UTSW	12	89254777	missense	probably damaging	0.99
R1621:Nrxn3	UTSW	12	88795710	missense	probably benign
R1637:Nrxn3	UTSW	12	89354468	missense	possibly damaging	0.94
R1659:Nrxn3	UTSW	12	90332391	missense	probably damaging	1.00
R1746:Nrxn3	UTSW	12	89255019	missense	possibly damaging	0.63
R1801:Nrxn3	UTSW	12	90283582	missense	probably damaging	1.00
R1912:Nrxn3	UTSW	12	88795342	missense	probably damaging	1.00
R1940:Nrxn3	UTSW	12	89260381	missense	probably damaging	0.98
R1993:Nrxn3	UTSW	12	89260411	missense	possibly damaging	0.59
R2002:Nrxn3	UTSW	12	90332315	missense	probably damaging	1.00
R2125:Nrxn3	UTSW	12	89260520	splice site	probably null
R2179:Nrxn3	UTSW	12	89254678	missense	probably damaging	1.00
R2207:Nrxn3	UTSW	12	89348312	missense	probably damaging	1.00
R2284:Nrxn3	UTSW	12	89510365	missense	probably damaging	1.00
R2433:Nrxn3	UTSW	12	89976392	missense	probably damaging	1.00
R2969:Nrxn3	UTSW	12	89354471	missense	probably damaging	1.00
R3053:Nrxn3	UTSW	12	89255101	missense	probably damaging	0.99
R3076:Nrxn3	UTSW	12	89260416	missense	probably damaging	1.00
R3078:Nrxn3	UTSW	12	89260416	missense	probably damaging	1.00
R4033:Nrxn3	UTSW	12	89533001	missense	probably damaging	1.00
R4222:Nrxn3	UTSW	12	89532992	nonsense	probably null
R4321:Nrxn3	UTSW	12	90199231	missense	probably damaging	1.00
R4470:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4471:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4472:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4686:Nrxn3	UTSW	12	89510651	missense	probably damaging	0.99
R4776:Nrxn3	UTSW	12	90331956	missense	possibly damaging	0.55
R4821:Nrxn3	UTSW	12	90204709	missense	probably damaging	0.99
R4869:Nrxn3	UTSW	12	88795582	missense	possibly damaging	0.95
R4910:Nrxn3	UTSW	12	89260360	missense	possibly damaging	0.72
R4960:Nrxn3	UTSW	12	88795201	missense	possibly damaging	0.79
R4990:Nrxn3	UTSW	12	89260474	missense	probably damaging	1.00
R4991:Nrxn3	UTSW	12	89260474	missense	probably damaging	1.00
R5057:Nrxn3	UTSW	12	89255034	missense	probably damaging	0.99
R5329:Nrxn3	UTSW	12	89813584	missense	possibly damaging	0.92
R5888:Nrxn3	UTSW	12	89512085	missense	possibly damaging	0.91
R6249:Nrxn3	UTSW	12	89254678	missense	probably damaging	1.00
R6264:Nrxn3	UTSW	12	90332237	missense	probably damaging	1.00
R6373:Nrxn3	UTSW	12	89976469	missense	probably damaging	1.00
R6401:Nrxn3	UTSW	12	89255000	missense	possibly damaging	0.46
R6434:Nrxn3	UTSW	12	88795515	missense	probably benign	0.32
R6528:Nrxn3	UTSW	12	89513049	missense	probably damaging	1.00
R6612:Nrxn3	UTSW	12	89813332	intron	probably benign
R6632:Nrxn3	UTSW	12	89193154	missense	probably damaging	1.00
R6874:Nrxn3	UTSW	12	90332190	missense	probably damaging	0.99
R7122:Nrxn3	UTSW	12	89510607	missense	probably damaging	1.00
R7328:Nrxn3	UTSW	12	88795575	missense	probably benign
R7352:Nrxn3	UTSW	12	88850293	missense	probably benign
R7425:Nrxn3	UTSW	12	89513100	nonsense	probably null
R7444:Nrxn3	UTSW	12	89510694	missense	probably damaging	1.00
R7483:Nrxn3	UTSW	12	89510462	missense	probably damaging	1.00
R7599:Nrxn3	UTSW	12	89512062	missense	probably benign
R7738:Nrxn3	UTSW	12	88850304	missense	possibly damaging	0.68
R7765:Nrxn3	UTSW	12	89813484	missense	probably benign	0.03
R8139:Nrxn3	UTSW	12	90204664	missense	probably benign	0.01
R8192:Nrxn3	UTSW	12	90204795	missense	probably benign	0.08
R8351:Nrxn3	UTSW	12	89510643	missense	probably damaging	1.00
R8368:Nrxn3	UTSW	12	90332041	nonsense	probably null
R8397:Nrxn3	UTSW	12	90331809	missense	probably benign	0.17
R8426:Nrxn3	UTSW	12	88795327	missense	possibly damaging	0.91
R8451:Nrxn3	UTSW	12	89510643	missense	probably damaging	1.00
X0019:Nrxn3	UTSW	12	90199221	missense	probably damaging	1.00
Z1176:Nrxn3	UTSW	12	89187055	nonsense	probably null
Z1176:Nrxn3	UTSW	12	89517909	missense	possibly damaging	0.45
Z1177:Nrxn3	UTSW	12	88795688	missense	probably benign	0.00
Z1177:Nrxn3	UTSW	12	89260312	missense	probably damaging	1.00
Z1177:Nrxn3	UTSW	12	90331845	missense	probably benign	0.05
Z1177:Nrxn3	UTSW	12	90332114	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAGACCACCAAAGATTCCCTGTCC -3'
(R):5'- ATCAGGCTGGGGTTTGAGATCACG -3'

Sequencing Primer
(F):5'- TGTCCATGACCTCTGAGGC -3'
(R):5'- GATCACGGTTATTCATTTTGCCAG -3'

Posted On

2013-10-16